HiSeq13 (mRNA) Ostrinia scapulalis

Overview
NameHiSeq13
Unique NameHiSeq13
TypemRNA
OrganismOstrinia scapulalis (Adzuki bean borer)
Sequence length433
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Transcriptome denovo Assembly of Ostrinia scapulalis2017-06-23
Sequences
The following sequences are available for this feature:

mRNA sequence

>HiSeq13 ID=HiSeq13|Name=HiSeq13|organism=Ostrinia scapulalis|type=mRNA|length=433bp
CCTGGCAACCCTACACGGGCCCAGTGAAGGGGAAGCGGGGCAGCGAGATC
CGGGTTGCGCGCCCACTGCACCCGGTGGCCCCCAAACACCGCGCAGTGTT
GACCTCTGCCACCAAAACGAAAATCGTCTTTGCGGACGCATCCGCCTATG
ACGACGATTTTCAATTTTGGAACACTTTATGTTTGGCAGGCCAGCATTTA
TTATCATAGCTATTCATATTTTTTATTGAGTCCCTACCAAACAAACTTTA
CTATCGTTTATGTTTAAGTACCTATTTATTAAGTAGTAAGTTGAACCAAC
TAAGAACATTTTTTTAGAGTGTGGAACTGTCTATCAGTCTCTAATCAGGT
ATTCATTCATACAATATATGTATAACAGAGACATTGTAGCAACAGGGAAA
AATGGAAAGTGATGGAGGAGGCTTTTACCCAAG
back to top