HiSeq15 (mRNA) Ostrinia scapulalis

Overview
NameHiSeq15
Unique NameHiSeq15
TypemRNA
OrganismOstrinia scapulalis (Adzuki bean borer)
Sequence length360
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Transcriptome denovo Assembly of Ostrinia scapulalis2017-06-23
Sequences
The following sequences are available for this feature:

mRNA sequence

>HiSeq15 ID=HiSeq15|Name=HiSeq15|organism=Ostrinia scapulalis|type=mRNA|length=360bp
ATTAAGTTTATTGCTACAATTTGGTTGTGAGGTTACCACCAGCCGGAGGA
CGCGTAGGAGTAGTGGGGCTCCGCGATAATCTTGGAGTACTTCACTACTT
GAGGGACGGATACCACCTTGGGGACTGACACGACCTTCTTCACTTCAACG
ACCTTAGGAACCTCAACGACTTTGTTGACGGAGACAATCTTGGCAGCAGG
CGCGTGGTGGTGGATGATAGGCGCGTGGTCGTAGAAGTGTGCGTCGTAGC
CGTGGTCGAAGTGGCCGTGGTCGAAGTGGCCGTGCCCGTAGTTGAGCGTC
AGGCCGTGGTCGTAGGAGTCGAAGTGGTCGTAGCCTCCGAGCAGGTAGCC
ACGCTTGTCG
back to top