HiSeq2 (mRNA) Ostrinia scapulalis

Overview
NameHiSeq2
Unique NameHiSeq2
TypemRNA
OrganismOstrinia scapulalis (Adzuki bean borer)
Sequence length215
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Transcriptome denovo Assembly of Ostrinia scapulalis2017-06-23
Sequences
The following sequences are available for this feature:

mRNA sequence

>HiSeq2 ID=HiSeq2|Name=HiSeq2|organism=Ostrinia scapulalis|type=mRNA|length=215bp
TTACACTTTCGACAGCTGTTTCAACAAACCCGCTCAGAAAGTCATACCAA
TACCCCCGTGCATCAACCGGAGACCAGTCGGCGAGTTCAATGCGGCGAAA
CGACGCGATTTGTGCACGACAGGAAAAGCAAACCGTGCGGTGCGTCAAGC
GACTTGAATATAAATTTGCTTTTAACAAACACCTATTTCACTGTAACAAC
AAACGACGAAATCAG
back to top