HiSeq3498 (mRNA) Ostrinia scapulalis

Overview
NameHiSeq3498
Unique NameHiSeq3498
TypemRNA
OrganismOstrinia scapulalis (Adzuki bean borer)
Sequence length258
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Transcriptome denovo Assembly of Ostrinia scapulalis2017-06-23
Sequences
The following sequences are available for this feature:

mRNA sequence

>HiSeq3498 ID=HiSeq3498|Name=HiSeq3498|organism=Ostrinia scapulalis|type=mRNA|length=258bp
CTTGTCGTAACCCTTATCTAACGGAGCGTGTGTGCGGGGAGTACGAGGGA
TGGGCTTTTTGTAGGAGATGGTTTGGGTTGAGGGAGAAGAGTTGGGTTGG
GAGGATTGGAAAGTGGAGCTGATGGTTTGTGAGGATGGAGATTTCGTGGC
ATCTGCATAAGACTTGCGGGCTGGCGGAAATTGGGAGGAGGCCTCGGAGT
ATGAGATATTGTCCTGAGACATGGATATTTTAATTGCTTTTTGGCGGGAG
TGTTCTGG
back to top