HiSeq3501 (mRNA) Ostrinia scapulalis

Overview
NameHiSeq3501
Unique NameHiSeq3501
TypemRNA
OrganismOstrinia scapulalis (Adzuki bean borer)
Sequence length262
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Transcriptome denovo Assembly of Ostrinia scapulalis2017-06-23
Sequences
The following sequences are available for this feature:

mRNA sequence

>HiSeq3501 ID=HiSeq3501|Name=HiSeq3501|organism=Ostrinia scapulalis|type=mRNA|length=262bp
GACAGAGTTCAATTCATAATGTGCGTGTTATTATAAACAATTTGTATTGT
GGATGCTACCGGTAAAACCCACAATAATTAACAGTTCAAAGTTGGCAGTT
TATCAGTACATTTTCATTGGTCGGTGACTCGGCCGAGGCGAGAAACTTAC
ATACCTATCAACTACTTGAGTATGTAGGTAATTGTAGCTACGCTGTTTGA
TAACCTAAGTAGGTAATTTGATGGTCACGGTCGGTACTGCGCACAGTAGT
CGGCAAGCGGAA
back to top