HiSeq3505 (mRNA) Ostrinia scapulalis

Overview
NameHiSeq3505
Unique NameHiSeq3505
TypemRNA
OrganismOstrinia scapulalis (Adzuki bean borer)
Sequence length357
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Transcriptome denovo Assembly of Ostrinia scapulalis2017-06-23
Sequences
The following sequences are available for this feature:

mRNA sequence

>HiSeq3505 ID=HiSeq3505|Name=HiSeq3505|organism=Ostrinia scapulalis|type=mRNA|length=357bp
CCCAGGTTCTCCGGAATACATTCTGGAACATTTGGTAAATTACACATAGT
TAATGGCACAATGGATAACAGTACCTATTTGGTTATCAAAGAGGGAAAAC
CACAATAAATTAGTAGCAATTACGGGAAATGCTAATTTGTCTTTTAAAGC
TCGAAACAAAACAATTGGAGGAATGACTCATCATTTTTTATAAAACAAAA
CAAATGGTTGTTTTGTATCTTCATGCATTGGTAGATATTTCCCTTGTCAC
ACACAAAGCATCAAAACTTTTACTTTTGTTTATATGAAAATTAAATTACA
TTTTAATTTAGTCTGACAGAACTGATGTGGATTTAACAATGTCTAAAAGT
GTACTGG
back to top