HiSeq3506 (mRNA) Ostrinia scapulalis

Overview
NameHiSeq3506
Unique NameHiSeq3506
TypemRNA
OrganismOstrinia scapulalis (Adzuki bean borer)
Sequence length335
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Transcriptome denovo Assembly of Ostrinia scapulalis2017-06-23
Sequences
The following sequences are available for this feature:

mRNA sequence

>HiSeq3506 ID=HiSeq3506|Name=HiSeq3506|organism=Ostrinia scapulalis|type=mRNA|length=335bp
GCCCGCGCCCGCGCCCGCCCCGCCGCGCACGCCCAGCTCCACGTAGTGCG
CGCCCTCCACCGTCACCGTCGAGCACGAGACCAGGTTGCCGAGGTGCGTC
TCCATGACGACCTGCGGCGCGCCGTGCTTGCACGTGAAGATGCGCAGGTA
GGAGTCGGACAGCAGCGCGCGGATGTCGTGCGGGCGGTCGCGCACGAGGC
GGTAGGCGAGGAAGCGCTCGGCGTAGTCGTTGCGGTTGAGCGCGTGCAGC
AGCGCGGCGCCCTGGGCCTGCGCGGCGCAGTAGCGCGGCAGCAGCCCGCC
CGCGCCCAGCACGCAGCGCGGCGGCCGCACGCGCG
back to top