HiSeq45 (mRNA) Ostrinia scapulalis

Overview
NameHiSeq45
Unique NameHiSeq45
TypemRNA
OrganismOstrinia scapulalis (Adzuki bean borer)
Sequence length206
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Transcriptome denovo Assembly of Ostrinia scapulalis2017-06-23
Sequences
The following sequences are available for this feature:

mRNA sequence

>HiSeq45 ID=HiSeq45|Name=HiSeq45|organism=Ostrinia scapulalis|type=mRNA|length=206bp
TTCGTGAGCTCTCATCGCCTTTCGGTGTGTTGCAGTATGGAGTTCATATA
AAGTGCATCTGGGGGCGGGCACTCGCTCCGTGCGAGTTAGTTTTGTTTTA
GCGTAGACCCCTAGACACTCAAGATCCGTGGTTAATGTTTATGTACTCTG
TGGCTGTGGAGATAAGACTCAGTTGTTCTAGCGTAGACTTCTAGACCACA
GACAGT
back to top