HiSeq5 (mRNA) Ostrinia scapulalis

Overview
NameHiSeq5
Unique NameHiSeq5
TypemRNA
OrganismOstrinia scapulalis (Adzuki bean borer)
Sequence length366
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Transcriptome denovo Assembly of Ostrinia scapulalis2017-06-23
Sequences
The following sequences are available for this feature:

mRNA sequence

>HiSeq5 ID=HiSeq5|Name=HiSeq5|organism=Ostrinia scapulalis|type=mRNA|length=366bp
ATCAAATGAACACAATGAGAAAAGCTATAGAGTCAGTATGGGTGGGCGCC
CGGAGGGGCTCCGCTGACGACCCGGCGGGCTACCGCTGGGGGCAAGGCCT
GGAGTTGAGAAGGACAGCTGCTGACGTCTACTCGGAGGCTGGCTTGGATG
ATCACTACCCTGTGTGGCTGAACCGCACCAGGGTCCCGGTACCAGAGGGT
GGCGCGGACTGCGTGGCGCTGGAGCGTGCGCGCCACGACCGGCCCGTCTT
CGTGGACTTGCCCTGCCAGATACTGAGGCCCTTCGCTTGTGAAAGAGAAG
CCCAAAAAGACGTAAAAGTGAGCGAATTGAAAGTGGTGCGATGTCGCGGC
GGCCTCTACCACGTGT
back to top