HiSeq54 (mRNA) Ostrinia scapulalis

Overview
NameHiSeq54
Unique NameHiSeq54
TypemRNA
OrganismOstrinia scapulalis (Adzuki bean borer)
Sequence length265
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Transcriptome denovo Assembly of Ostrinia scapulalis2017-06-23
Sequences
The following sequences are available for this feature:

mRNA sequence

>HiSeq54 ID=HiSeq54|Name=HiSeq54|organism=Ostrinia scapulalis|type=mRNA|length=265bp
GAGTGAACATCCTTGTAAGGGATTGTAGTAAAGTCATTTGCAACCAATTT
GGTTACAAATATTCCTAGTCAAATGTCAACCATTTATGAGAAATTTTATT
TCAATGTTGTATGGATAAATCATAAGGGAGGTGGTACTGCTAGATAGCCA
GTTCTCCTTTGGTTGAGGCTCCGGGTCGATCGGTCCTAGCAGAGGATGCT
GGAAGGCATTTGGTTGAAACGAACATACTTACTTTGAACATACCGTGCGA
TGTGAAAGTCATTGG
back to top