HiSeq60 (mRNA) Ostrinia scapulalis

Overview
NameHiSeq60
Unique NameHiSeq60
TypemRNA
OrganismOstrinia scapulalis (Adzuki bean borer)
Sequence length209
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Transcriptome denovo Assembly of Ostrinia scapulalis2017-06-23
Sequences
The following sequences are available for this feature:

mRNA sequence

>HiSeq60 ID=HiSeq60|Name=HiSeq60|organism=Ostrinia scapulalis|type=mRNA|length=209bp
GTTGAACCTAACAATAAAACACCATTTGGATTCTTGCATCCCACACATGT
TTACCGAGACGAATTCAATGGAGAACCTGTTCAATCCACTTTAGTTTTGA
CCGTAAACTTTCATTTCTTTGTGATATCATCAGTATACATTTTAGAGTAT
CTTTTTTGTCATACTCCTTTGTGATTAGCATGTACGACAAGTGTCATTTA
GGCCACTTT
back to top