HiSeq8 (mRNA) Ostrinia scapulalis

Overview
NameHiSeq8
Unique NameHiSeq8
TypemRNA
OrganismOstrinia scapulalis (Adzuki bean borer)
Sequence length261
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Transcriptome denovo Assembly of Ostrinia scapulalis2017-06-23
Sequences
The following sequences are available for this feature:

mRNA sequence

>HiSeq8 ID=HiSeq8|Name=HiSeq8|organism=Ostrinia scapulalis|type=mRNA|length=261bp
AAATATAGCGATTAGCGGTTTATGATCAGTACGAAGTACAAAAGGAATGG
ATCTACCGTATAAATATTGATGATATTTACGAACACCAAATATTATAGCT
GTTGCTTCCTTTTGTATTTGTGAGTACCTACGTTCAGCTGAATTTAGAGT
GCGTGAGGCGAACGATACAGGGCGTTCAAAACCACTTTCATCAATTTGAG
ACAAAACCGCTCCCAGCCCACCTGAGGATGCGTCAACAGTCAAAATGATC
TTCGCACCGGG
back to top