OSCA020129-RA (mRNA) Ostrinia scapulalis

You are viewing an mRNA, more information available on the corresponding polypeptide page

Overview
NameOSCA020129-RA
Unique NameOSCA020129-RA
TypemRNA
OrganismOstrinia scapulalis (Adzuki bean borer)
Sequence length315
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
newscf_19935contignewscf_19935:356..3230 -
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly (v1.2) and Annotation (v1.2) of Ostrinia scapulalis2017-06-22
Properties
Property NameValue
eAED0.78
QI11|0|0|1|0|0|2|226|25
AED0.18
Relationships

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesTypePosition
OSCA020129OSCA020129Ostrinia scapulalisgenenewscf_19935 356..3230 -


The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesTypePosition
OSCA020129-RAOSCA020129-PAOstrinia scapulalispolypeptidenewscf_19935 3142..3219 -


The following three_prime_UTR feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesTypePosition
OSCA020129-RA:three_prime_utrOSCA020129-RA:three_prime_utrOstrinia scapulalisthree_prime_UTRnewscf_19935 356..546 -


The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesTypePosition
OSCA020129-RA:cdsOSCA020129-RA:cdsOstrinia scapulalisCDSnewscf_19935 3142..3219 -


The following five_prime_UTR feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesTypePosition
OSCA020129-RA:five_prime_utrOSCA020129-RA:five_prime_utrOstrinia scapulalisfive_prime_UTRnewscf_19935 3220..3230 -


The following exon feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesTypePosition
OSCA020129-RA:exon:3708OSCA020129-RA:exon:3708Ostrinia scapulalisexonnewscf_19935 356..546 -
OSCA020129-RA:exon:3709OSCA020129-RA:exon:3709Ostrinia scapulalisexonnewscf_19935 3107..3230 -


Sequences
The following sequences are available for this feature:

mRNA sequence

>OSCA020129-RA ID=OSCA020129-RA|Name=OSCA020129-RA|organism=Ostrinia scapulalis|type=mRNA|length=315bp
GAAGAGCCTGGATGCGGGCAGCGCAGGACCGTGCATTGTGGAAAACCTTG
GAGGAGGCCTTTGTCCATCAGTGGACGTCATTTGGCTGAAACGAACGAAC
TACATTAGTTGGAAACTTTGTAAATCACATTACTTAAAAGGCACTCTCAC
TCAAGTAAGAGTCAATAAAAAAACNCAGCGTGAGACGTCCACCCACAAGG
TGGACCAACGACATCATAAAGGTAGCAGGAAGGTGCTGGACGCAGGCCGC
TACCAACCGGGCAACATGGAAAGCATCGGGCAAGCCTATGTTCAGCAGTG
GACGTCCTATGGCTG
back to top

spliced messenger RNA

>OSCA020129-RA ID=OSCA020129-RA|Name=OSCA020129-RA|organism=Ostrinia scapulalis|type=mRNA|length=315bp|location=Sequence derived from alignment at newscf_19935:356..3230- (Ostrinia scapulalis)|Notes=Excludes all bases but those of type(s): exon.  
GAAGAGCCTGGATGCGGGCAGCGCAGGACCGTGCATTGTGGAAAACCTTG
GAGGAGGCCTTTGTCCATCAGTGGACGTCATTTGGCTGAAACGAACGAAC
TACATTAGTTGGAAACTTTGTAAATCACATTACTTAAAAGGCACTCTCAC
TCAAGTAAGAGTCAATAAAAAAACRCAGCGTGAGACGTCCACCCACAAGG
TGGACCAACGACATCATAAAGGTAGCAGGAAGGTGCTGGACGCAGGCCGC
TACCAACCGGGCAACATGGAAAGCATCGGGCAAGCCTATGTTCAGCAGTG
GACGTCCTATGGCTG
back to top

protein sequence of OSCA020129-RA

>OSCA020129-PA ID=OSCA020129-PA|Name=OSCA020129-RA|organism=Ostrinia scapulalis|type=polypeptide|length=25bp
MRAAQDRALWKTLEEAFVHQWTSFG
back to top

mRNA from alignment at newscf_19935:356..3230-

Legend: exonfive_prime_UTRpolypeptideCDSthree_prime_UTR
Hold the cursor over a type above to highlight its positions in the sequence below.
>OSCA020129-RA ID=OSCA020129-RA|Name=OSCA020129-RA|organism=Ostrinia scapulalis|type=mRNA|length=2875bp|location=Sequence derived from alignment at newscf_19935:356..3230- (Ostrinia scapulalis)
GAAGAGCCTGGATGCGGGCAGCGCAGGACCGTGCATTGTGGAAAACCTTG GAGGAGGCCTTTGTCCATCAGTGGACGTCATTTGGCTGAAACGAACGAAC TACATTAGTTGGAAACTTTGTAAAGTTGTTTTTTATTTATTTAGCAAAGT AATCTAATTAGTAGGTAAATTAATAAAGCGACAATAGCCCAAAGGTGTCG GTGTCCAACTGGCCGAATCGACATCCGGGAAAGAAGGGTTCGAACCCCGC CGCTGGACTATTGTGGTGAACTCGTAACACAAGCATGCTTACCACGAGGG GAAAAATAAAAGTAACTAGGTATTCTATCAAGTGAGAGATTACAGGTTTT CATAAATTATTGGATGTGGCACGAAAGTCTACCAATACTACAAATAGAAT AAGTACTAGAAAGTTCTAAATTCAATAAAACACGAATAAAATGTTAAGCT ACCCTTATTTTAACCGTTTTACGACGCAACAGCGGTGACGCCTCGAATCG ACGCCTGCGCACCTCAGATGTGACGTTTATGGCGCACTAACAGTAACTCA TTGTGAGTTACTCAGGGAATAACTGGTATCCCTGGAAAACGTTTATGTCT TCGAGACGGTTGTCTTTTGTCTTTATTTTTGGCTAAAAAAGGTTTGTTGT GAGAATTACTTTACTACCACTTTGAGTTAGGGTAGTTGANNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCATAACCACA ACAAGCACAAATTGAATTACAATAACACAAAATGTTGTAATTAATTACTA TTATCGTCTGTCTGTCCATACGGATTGAAATACATGCGTCTGTCTGTCCA AAGATGATTTATCTGGCAATAATAATAGAACGACTGAGATAACRATTTAT TTACAGATGTTAACTACTAAGATTAACTTCGCAATAGTAAATTGTGAAAA CTACAATTAATTAGGTAGGTCTTCATTTTTTCAGTCACATTACTTAAAAG GCACTCTCACTCAAGTAAGAGTCAATAAAAAAACRCAGCGTGAGACGTCC ACCCACAAGGTGGACCAACGACATCATAAAGGTAGCAGGAAGGTGCTGGA CGCAGGCCGCTACCAACCGGGCAACATGGAAAGCATCGGGCAAGCCTATG TTCAGCAGTGGACGTCCTATGGCTG
back to top

Coding sequence (CDS) from alignment at newscf_19935:356..3230-

>OSCA020129-RA ID=OSCA020129-RA|Name=OSCA020129-RA|organism=Ostrinia scapulalis|type=CDS|length=78bp|location=Sequence derived from alignment at newscf_19935:356..3230- (Ostrinia scapulalis)
ATGCGGGCAGCGCAGGACCGTGCATTGTGGAAAACCTTGGAGGAGGCCTT
TGTCCATCAGTGGACGTCATTTGGCTGA
back to top
Synonyms
The feature 'OSCA020129-RA' has the following synonyms
Synonym
maker-newscf_19935-snap-gene-0.1-mRNA-1