BAP2ALocus_1017_Transcript_1/6_Confidence_0.357_Length_5432 (mRNA) Venturia canescens

Overview
NameBAP2ALocus_1017_Transcript_1/6_Confidence_0.357_Length_5432
Unique NameBAP2ALocus_1017_Transcript_1/6_Confidence_0.357_Length_5432
TypemRNA
OrganismVenturia canescens (vcanescens)
Sequence length5432
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Venturia canescens transcriptome v1.02018-05-04
Sequences
The following sequences are available for this feature:

mRNA sequence

>BAP2ALocus_1017_Transcript_1/6_Confidence_0.357_Length_5432 ID=BAP2ALocus_1017_Transcript_1/6_Confidence_0.357_Length_5432|Name=BAP2ALocus_1017_Transcript_1/6_Confidence_0.357_Length_5432|organism=Venturia canescens|type=mRNA|length=5432bp
TATGTCGTTTTTTTTTTCATGTTTATTTGCAGTTTTCTCGTATAATTGGT
AACTGATTTTGGATAACTAGTATACTAAAAATCTAAACAATGTACGAAAC
TTTATACATAGCTAATTTTGTTGTATTTCGAGGATTTTCAATATTTCTTG
TCTCATGTTGTTGTTGTTGTTTTTTTTTTCTCTTAATGACAGCTATTTAC
AAAAAAATTAGTTGAATCACGCCGACGATCGCCCGAAAAAAATGGCCGAA
GGGACCTGATTTTTTTCTTTTTCGCTTGAACCGCGTGAAAATGTGGCGAA
CCGTGGCGTGACTCGGGCACTCTACGGAAGATTAGATTTGTGTGTATCTC
TTCCCCCGCGCGATCTATAAATTGCCTGTTCTCGCATGAACTTGATAGAT
TTTTTACAAACATTTAACGTTCTTCATTTTGTTCACCGTTCCATTTTTCT
TCGTGTGTATGTGTGCGCGTGTCCGTCGTGTGTGATTGGAATGTCCGATC
CAGCGAGCCGTCTGGAATATTCGTTCAAGTACAGGCAAGTACGATTAGCT
TTTCGGTACTCGTTTGATTGACTAAAAAGAACAGCGACGAGAACTCGGTT
TTTGTTTTGTTTTACACATTTGTACGAAACTCATCTTAATTAGTGTAAAA
TTTATTGTGCGCTGATATTAAAATGTCTGGGCCTCGCTGGATCTGGATTA
AAATTTATTTTTCAACATTTGTATACTTATTTTCAATTTTTCGTCACAAT
TATTCCATTTCCCTTTAGTACATAAATCCCCAAGTGATTCTCTCCTGCTG
CTCTCTTTTTAACCACCGACTCCGAAGAGTTCGAACATCGTACGAATTTA
ATATGCCGGAGAGCGGACACAATCGACCAATTGACCTGAACTCTGATCTC
GGAATTCCAGACTCGACGATGACCGATAGAGCGTCTCGTATAACGGAGTC
GTACGCAAAAAAGTCCCGAGTAAGAGAGACGGAGTGAGAAAGAGAGTCAG
GTCGAGATCATGCGGAATAACCACGTACGTTACTCGGTTAGTACATATTT
GTTGTGCAAAGTCTTGACATCGAGTTTCGTAACAGGCCGAAAAACAATAA
TAACCAATTCGTCGTAAACGCACCAAAAGTTTTTAGATCCACAGTTGTGT
ATCTCTTATTCTCAAGAAGCATTTTTTCAAAATGAATAAACAAGTTAATG
GAACTGTACAAAAATTCAATTCACAATATTTCCGGCTTCGAACGATTATT
TTTCACATTCGAATTGATGAAATTAACAAAAATCATATAAGACAAATAAA
ATTTGTGATAAATTTGGTTTTTATTCACGTTTTTATACTCTTCATCGATT
CGTTCACTCGATCTTCCGCCAGTTTTTTCCTGCCGAAAATTGCACTGAAA
AAATCACGTACTACGCACAGTACGAATGATTCTCGTGAAAAAGAAGGAAA
TCAAATCAATTTGCAACGACATTGCAGATCTTCTCTTCTCGTTTCCTTTT
TGTTTAAATAAATATACATAAATGCTTGCCTACGCGCGATAAATTGAGAA
GACTCGTACAACAACGTAAACGAATTACGTTTTGCCACGACCAAAAATAT
AAAATTATTATCATCTGTATTTATATATTATTGATAGTAATAATATAAAT
ATATAATAATGAAATTAATCGTGCGGGGGAAACGCGAGAATACCTCACAT
GAGCTCTAGAAGCTACGGCTCTATTTTTTTCTCCTTTTTCTTTTCGTTCA
CTTTTTTCTTTTAAAATAATGGAACATCATTACGAGTAACAGAAATATTT
TTATATAAATGTAAATTAACTAAGGCCCTGTCGCGTCCGCGCGACAATAA
TCCTTATTTCTTATGCTCGCTTCATTCTGTTTTTTTTTCTTTTTTTCCAT
TAAGTTTTCCTTTTCATTATTTTTCATTTTAATTATAATTACAATTATGA
TTCCATATTGTGTTTTTTTTTTTTTTTTTATGTACAGAGACGCACGTTTT
CCCGTACGCGATTGGAAATGGAGTTTGGCGTTCGATTTAAGGAAGAAAAA
TATTAAAAAGAATAAACAAAACAAAACTAAGCAAAGTTACACATCGATAA
TCCTGGATGAGTCGCGTCCAAAGTTCGGATGGATGGATCACGTGACGAAT
CGAATATACAGGGTGAGGCACGTAAAGTGTCACAGAGCACTCGAATTCAT
ATCCAAAAATGTTTCAGACTAAAGTTTCAGTGTTCAGAAAGGCAGTCTTA
CTCGACCACCTTTTTTTTTATATCGTTGTAGGCGCCGAAGTTGCATCAAC
GTAAACTTCACTATTTTAAGTGGAATCGTGTACTTTTATCAATGACATTA
TTACCGATTTTAAAACTAATTCGACAGCGTACGACGTTTTTATTCAAGAT
AAACTCATTGTCGAAAAATCGAAAACTGCTCTGTAACACTAATTTATGTG
CCTCATCCTGTATGCGTATAAATATCGTGCGAGAGACGACAGGAAAACGC
GCTCTTAAAATAGTATCTCTATATATACAAACAGTATGTGTACAGTGTTT
TATATATATATATAATCAATACATTAAACATTCGTAAATGACGGATGGTC
CTTAGTTTATTTGAGACGCGTTGGGAGGAGGCTCGGTCATCGTTGTAAAA
GTTGAATAACCAAAAAGCGTGAATGTCACGCTAGAAATTTTGATTTTTTT
TCTAATTTGTATGTGAAATATTGCCGCGGTGCAGAGAAGGAAAAATAATT
TTATAAAATGTTATGATTATGCGAAAAAAAAACAAAAGTTAATCTGATTG
AATAATTAAAAATGTGTTTGTACAATTTATCGTCGTCAAGTATTTTCGTA
ATTAATTAATTGAATTGTGAAAATTCGGGGTAAAAGGTAAAAGACAACGG
TTCGTCGACAATCCGAGGCTCCCCGAAGGATCAAATACAAAATCTTTTCC
GGATCACTCGCTACGGCAAGGAGAAAATCGCATTCGTCGCCGGGGCGAGT
GTCGATGGATCGCGAGATCATTTTCAACAGAGGCGCTCACCGTAGATTTA
CGTAATGTGCTTGTGTTTCTGTGTGTGTGTATGTGTGTGTGTATTTGTAT
TTTGTGTGCGCCGAATCTTAGTGTCGGGGTAATTAAAACGAAGGAAAGAA
TAAATAAAAAAAACTATGGATTCGGACTTTTCAACGGTGCCTCGAAGTTC
TCATCCTCGAGCGTGGAGGATCGAGTCCTCGATCGTTGTCCGCGCAGTTG
ATTCCTCTGACGACGGAACAAAAAGCGAAAGACAAGATTAGGTTTTTGGA
AATACGCATCGAAGAGATCCTGAGCTCCGGAAAGTCTTTTACAACGTCTA
CGATACACCCGTCCCTTTGACCTTCGTAAACTCGTTCAAGTCGTCCAAAC
CCTCGTTCGATGACGAATGAGTTTGTCAGGTATTTCCATCTATACAGAGT
CTCTCTCCCTCGCAGTACAGGAAAAGTTGTTTTTGTGTTCTCCTTCCACG
TTGTTGTTTATAACATACACGTATAGATATTTTGTTTCTTCTCTCTTTTT
TCTTGAATTTTTTTTAACGAGTGTGTCTCTCTCGATTAACCGTCAAATTT
CTATCCAGTCTCATGGTCCTCGCGAGGGGATCGGTTTTCGAAAATTATTC
GCGTGTATCAACCGCCACAAAAAGAAAAGAAATGCTTTTTTCTTCTCCTC
TTTTTGAAATATTTCCTATTTTTCTTAGTCTCGTTCCCGGCCGCGTTTAC
TCCAGTTTCGTAATATTCACTCTAGGTCTCAAGGCCCGGGACGAGACTGT
GAAACGTTTGAATGTCGTGAAAGGCTCGTCCGCAGCTCTGATTGTTGTTC
CTCTCAAATTTAGCTAGATCAAAGTGCTCGTCGAGAGTTTGAAGCTCGAC
TAAACGTTCCTCGAGGCTCTTCGCGGAGTCAGCGAATCTCGCAAAATCGC
AAATTCTGTCGGTTTCGTCGCTCACGTCCATCAGACTCACGTCATTGCTG
CTGCCTGATCTCCCGATTCCCGAATCAACGAGATCCTGCGAACAATATAA
GCCGTTCGAGGTGCTCGACGACGATGACGTCACACCCCGCAATTCGCTCG
GGCACAAACGATCCTCGTGATAGCTCTGTATCGAATGAGGTGACGTTTGC
GGCTCGGGAACATCGTCGATGTGCGACAACAAACGGGGCGTCGGTGGCAG
TATGTAAAAGTCACTGAACACATCGTCCTGGAGATCCAAATCGTCGTGCC
TCTGCCGTTTTGGACTGAGGCTCTCGTTGCTTCTCATTTCCTCGCCCAAT
CTCTTTTTCGATGAATTGTCGGCGTCCATGTGATTTCCACTGAGATTATT
TTCCTTGGAGGAGTCATCGAGATAACTGACGATGGGTAATCCGTAGTTTC
GTGTCTTCTCGTCTCTGTTCTCACGCTGGAGGCGTCTGACGGCATTGTTA
ATCAGTACTGAGCGACATAGGCTCGCCTCGGGATCTTCGATGCGTCGCAA
TTTGCCGGCCGATATTTTCAACAAACGTCTGCGCTCCTCGCGTGCACGGT
ACTTGGCGGATATCATGGTTGGTCGACTCCTTCGAATCACCAGATCTTCC
TCCAATCTCATCTTAAAGTCGCGATCTATATAAGCCGATGATTATCCGTT
TGTCCGATCGATCGATGATTCTTCCGGGCAAACGTGAAAGATTTATCCAG
TGTTCTCGAGCGCGTGCATATATATTTGTGTATGTGTGTGTGTGTTTCAC
TCGGTCAACGTTTTTCTCTGATTTTTTATTTTTCAAACTCCTTTGTGCAC
AGTTTCGTCCGATTCAATATCGGGATTGACACACGAAAACTCCCTCACAA
AAGAATTATTTTCCGCTTTCCTCTCAATCACTGTCCCGCCAGTGTTTCTA
TCGTTTAAGCTTCGTTTCGATCGATTCTTTATTTTTCTTTTCTTTTAACC
AACTTAACAACACTTGACAAATATTCCAACACTCTTAGTTACTTGCACAA
TCACGAAGGACACTGAGTAAAACACGTATGTTCGATCTGTCTCGTGTGAT
TTCTAAAACTCAATATATTATGTTGTTCCTTTGATGTATTACGCATTGAC
ACACAGTATAAACGATTGCACACGAATGCGAAGCGAATGAGAATTGACTC
TCGCGCGCGCGGGTGCCCCTTCCTCTTTACACGACGCGACACGTAAACAT
GCAATATTCCTTGAGTCTCTCTCGCTCGCTCAGTTGTGTGTTAGCGGGCA
AAAACGAAAGGAGAGCGAGGGGAAGAGGAGAGACGAAGGCGACGAGGGCC
GCCAAGACTACGAGGCGAAAGAGGGGTAGGTTCGGGTACGACGTACCGTA
ACGACGTAACAACGGGGGTCGTGGAACAAGCGCTGCGGCCGAAGGAGCTC
CGTACGCCACCAAGGACCGTGCGCGACTGACT
back to top