BAP2ALocus_1058_Transcript_1/11_Confidence_1.000_Length_169 (mRNA) Venturia canescens

Overview
NameBAP2ALocus_1058_Transcript_1/11_Confidence_1.000_Length_169
Unique NameBAP2ALocus_1058_Transcript_1/11_Confidence_1.000_Length_169
TypemRNA
OrganismVenturia canescens (vcanescens)
Sequence length169
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Venturia canescens transcriptome v1.02018-05-04
Sequences
The following sequences are available for this feature:

mRNA sequence

>BAP2ALocus_1058_Transcript_1/11_Confidence_1.000_Length_169 ID=BAP2ALocus_1058_Transcript_1/11_Confidence_1.000_Length_169|Name=BAP2ALocus_1058_Transcript_1/11_Confidence_1.000_Length_169|organism=Venturia canescens|type=mRNA|length=169bp
ATTTCATCAAAAAATGTTGCATTTTTTCGCACACATTTTTGATGTTTATT
TGTTTTTTCTTTAGTGACAAATCTGGTGCCATAATACATTTTATATATCT
ATATATTTTTTTCTGGTGTCATAATACAAATTGTATACCTATATATTTCC
ATGAATCTGTTCATGCTTC
back to top