BAP2ALocus_1058_Transcript_10/11_Confidence_0.263_Length_2004 (mRNA) Venturia canescens

Overview
NameBAP2ALocus_1058_Transcript_10/11_Confidence_0.263_Length_2004
Unique NameBAP2ALocus_1058_Transcript_10/11_Confidence_0.263_Length_2004
TypemRNA
OrganismVenturia canescens (vcanescens)
Sequence length2004
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Venturia canescens transcriptome v1.02018-05-04
Sequences
The following sequences are available for this feature:

mRNA sequence

>BAP2ALocus_1058_Transcript_10/11_Confidence_0.263_Length_2004 ID=BAP2ALocus_1058_Transcript_10/11_Confidence_0.263_Length_2004|Name=BAP2ALocus_1058_Transcript_10/11_Confidence_0.263_Length_2004|organism=Venturia canescens|type=mRNA|length=2004bp
TAACGCAACCACGTTTTCCTCGCTTTTCGAGCCTGCCAGCGGTACGGAAA
TTATGCTTCGAGTGTATGGATTTTGCTGCCAGATTTTCATGCCTATATTG
ATGAAAAAGTACCGGGAGTGTGGAGATGAGAGCCAGGAAAAATCGTTAGA
ACCGAGTGAAATACAAGGATAAGAAAAACTGAAAATTTTTGGGCTATTTT
CGAGAATGGGGCTGCAAGGAAGTAACTCACCGGCACAACGACACGAAGAT
CGATCAGACTGCGATCAGAAGAGACGAAATCTCGAAGCAGAGTCCAATGA
TCCCGAAATGGACAGTAATACGACAGATGTGCACATCCGATTGCACAATG
ATAATAACTTGTTTAGTAATGAAAAAGAAAAAGCAGAATTTTTTGTTAGA
TATCGTGGAAAAAGTTACCAAAATAAGTGATTTACTTAAAAAGCATCCCG
GTGGTCGTGGTACACTCGGATCATTCAAAGGATTAGCCTTGGACAAAATT
ATGACCGAGGTACCACATTCGGATGCCGCGTTACACCTTATGGAGGAATT
TGTCGTCGATAATCAAAGGAAATACGACGATATTGAGAACTTAATTGATT
GGAACGGACCCTGTACTCGGTCAAGTGGGAAAAATAGCCGATCGTTACTG
GGAATGGGTGAATCTTCCAGTGAATCGTTCAATGCGCCTTTTCAAGTCAG
ACTTTATGGAAAGTTTGACAATCACACCGTGGTACATGATACCAATTGTG
TGGATCCCAGCATCGATATTATTTTTGTTTCTGGGCATCAAGACAAACAA
TTCCGCAGACTTTCCTTATGCGTTTCCCGCAGTACTGTTATCAGTTGTTT
TGGGTCTTTTCAATTGGACTATTTTAGAATACGTTATACATCGAAATCTC
TTCCATTTGAAGCCACCAGCAAATTCGAGAACTCTAATCACGCTGCACTT
TGTTCTTCACGGAGTTCATCATAAAGCACCCTTTGACGATCGAAGATTAT
TATTTCCACCTGTTTCCAGCCATTTTAGTAGCTGCCATATTTTTCAAAAT
ATACAGCGCAGTTTTACCAGATGCAATTGTATATTTGGTTGCATCCGGCA
CCATGACAGGATACTTTTGTTACGACTTAATGCATTATTATTTACATCAC
GGTAGTCCAAAAGCAGAATCGTATCTCTACGTCATGAAGCGATATCACAA
CCATCATCATTTTTCGCATCACGACCAGGGATTCGGGATTAGTAGCCGCT
TGTGGGATTTCGTATTCGGATCATTGATAAAGTTGAAACAACTGAAGAAA
GCGATAGTTTGGTAATAAAATCAAAGATCGTCACCATTTAACTCTTAATT
ACTCTTAACTTTATTTTTTTCAATGAACTATATTAATCGCATTACAATAT
TGAGAACGCCGTTATTGTTTTTGAATATTCCATACTGATTATTTTGTGAA
AAAAAAAAAAAAATCAATTCCATGAATTTTGCAAATGCTCTGTAAACGTT
TGCTCTCCTTATCGGCGGTATGGTCCCATCTTCGCAACTGAGATGCGCTA
AACGAATGCATTCGTCGTCAACGTCAAGAGGCGTGACAATTTTTTCGAGA
AAATTTGCATAGTGAACGCAGCACAATAATTCTCTCGATCCTCTTTTATC
AACAGGCAATTGTTAAGTACGATTAAGCGATAACGAGACATATCAATAGT
CAAGTGACAAATAATCTTGAGCTTTTTTTCACCGGTTAAATTTACTTGCA
AACATTTTTTGTTTCGCTAGGACAAACTTCAGACACGAGATGTACGAACA
TTTGAACAAACGAGTTTTTACAAATTTGGGACGAATAATATTGATAAATT
TTTTTTGGAATGTTCACGATTCATTTGCATTTCAAGCTACTAAACAAAAA
ATTACATCAGTAGAATACATTTCAACTGAGAATCAAAGACAAAAAAGATT
ACGACGCTGAAGTTTCCAACGTTGGAGTCCAACGAAATGAACGAAAANNA
CGTT
back to top