BAP2ALocus_1058_Transcript_4/11_Confidence_0.237_Length_1725 (mRNA) Venturia canescens

Overview
NameBAP2ALocus_1058_Transcript_4/11_Confidence_0.237_Length_1725
Unique NameBAP2ALocus_1058_Transcript_4/11_Confidence_0.237_Length_1725
TypemRNA
OrganismVenturia canescens (vcanescens)
Sequence length1725
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Venturia canescens transcriptome v1.02018-05-04
Sequences
The following sequences are available for this feature:

mRNA sequence

>BAP2ALocus_1058_Transcript_4/11_Confidence_0.237_Length_1725 ID=BAP2ALocus_1058_Transcript_4/11_Confidence_0.237_Length_1725|Name=BAP2ALocus_1058_Transcript_4/11_Confidence_0.237_Length_1725|organism=Venturia canescens|type=mRNA|length=1725bp
GAGAACTCTAATCACGCTGCACTTTGTTCTTCACGGAGTTCATCATAAAG
TAAGAACAGAAGTCATATCGGAACAGAGGAAAATGATCTTCTCACACATT
TTGCTCGACTCCAAAAAAATCTCTTTTTTTCCAGGCACCCTTTGACGATC
GAAGATTATTATTTCCACCTGTTCCAGCCATTTTTGGACTATTTTAGAAT
ACGTTATACATCGAAATCTCTTCCATTTGAAGCCACCAGCAAATTCGAGA
ACTCTAATCACGCTGCACTTTGTTCTTCACGGAGTTCATCATAAAGCACC
CTTTGACGATCGAAGATTATTATTTCCACCTGTTTCCAGCCATTTTAGTA
GCTGCCATATTTTTCAAAATATACAGCGCAGTTTTACCAGATGCAATTGT
ATATTTGGTTGCATCCGGCACCATGACAGGATACTTTTGTTACGACTTAA
TGCATTATTATTTACATCACGGTAGTCCAAAAGCAGAATCGTATCTCTAC
GTCATGAAGCGATATCACAACCATCATCATTTTTCGCATCACGACCAGGG
TGAATGACTCATTTATTTGTTTTTTTTTGCATCCTCCAAATGCTTGAAAA
TACATTTTTTTTAGCTGAACATCATGAAATTACTTTATTCAATAGAAATA
AAAAACTTTTTTTATCGTTCTTTGAGAAACATGAAGAAGCCACAAAGAAT
TGTGTCGCACTCGAGCGACAGTTCTTGTTATTGGATGGAAACAATTTCTC
TTTGCGTGCACGTATTTCTCACTCTATTAGTTATTCTTTTTTCTGCCACG
TAAAATGATTGATCTATTGTTGCAGTTTGTCGCTGCGTATTGATTGTAGA
GCCTGGTAAAAGTGTCGTGCATTCGAACGATTATAATGGAATTACTCAAA
TTATTGTGAAATCGTCGCTTGTAAAGAATGAATGCTTTTTTTTCTTCCAG
GATTCGGGATTAGTAGCCGCTTGTGGGATTTCGTATTCGGATCATTGATA
AAGTTGAAACAACTGAAGAAAGCGATAGTTTGGTAATAAAATCAAAGATC
GTCACCATTTAACTCTTAATTACTCTTAACTTTATTTTTTTCAATGAACT
ATATTAATCGCATTACAATATTGAGAACGCCGTTATTGTTTTTGAATATT
CCATACTGATTATTTTGTGAAAAAAAAAAAAAAATCAATTCCATGAATTT
TGCAAATGCTCTGTAAACGTTTGCTCTCCTTATCGGCGGTATGGTCCCAT
CTTCGCAACTGAGATGCGCTAAACGAATGCATTCGTCGTCAACGTCAAGA
GGCGTGACAATTTTTTCGAGAAAATTTGCATAGTGAACGCAGCACAATAA
TTCTCTCGATCCTCTTTTATCAACAGGCAATTGTTAAGTACGATTAAGCG
ATAACGAGACATATCAATAGTCAAGTGACAAATAATCTTGAGCTTTTTTT
CACCGGTTAAATTTACTTGCAAACATTTTTTGTTTCGCTAGGACAAACTT
CAGACACGAGATGTACGAACATTTGAACAAACGAGTTTTTACAAATTTGG
GACGAATAATATTGATAAATTTTTTTTGGAATGTTCACGATTCATTTGCA
TTTCAAGCTACTAAACAAAAAATTACATCAGTAGAATACATTTCAACTGA
GAATCAAAGACAAAAAAGATTACGACGCTGAAGTTTCCAACGTTGGAGTC
CAACGAAATGAACGAAAANNACGTT
back to top