BAP2ALocus_1058_Transcript_5/11_Confidence_0.316_Length_2527 (mRNA) Venturia canescens

Overview
NameBAP2ALocus_1058_Transcript_5/11_Confidence_0.316_Length_2527
Unique NameBAP2ALocus_1058_Transcript_5/11_Confidence_0.316_Length_2527
TypemRNA
OrganismVenturia canescens (vcanescens)
Sequence length2527
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Venturia canescens transcriptome v1.02018-05-04
Sequences
The following sequences are available for this feature:

mRNA sequence

>BAP2ALocus_1058_Transcript_5/11_Confidence_0.316_Length_2527 ID=BAP2ALocus_1058_Transcript_5/11_Confidence_0.316_Length_2527|Name=BAP2ALocus_1058_Transcript_5/11_Confidence_0.316_Length_2527|organism=Venturia canescens|type=mRNA|length=2527bp
TAACGCAACCACGTTTTCCTCGCTTTTCGAGCCTGCCAGCGGTACGGAAA
TTATGCTTCGAGTGTATGGATTTTGCTGCCAGATTTTCATGCCTATATTG
ATGAAAAAGTACCGGGAGTGTGGAGATGAGAGCCAGGAAAAATCGTTAGA
ACCGAGTGAAATACAAGGATAAGAAAAACTGAAAATTTTTGGGCTATTTT
CGAGAATGGGGCTGCAAGGAAGTAACTCACCGGCACAACGACACGAAGAT
CGATCAGACTGCGATCAGAAGAGACGAAATCTCGAAGCAGAGTCCAATGA
TCCCGAAATGGACAGTAATACGACAGATGTGCACATCCGATTGCACAATG
ATAATAACTTGTTTAGTAATGAAAAAGAAAAAGCAGAATTTTTTGTTAGA
TATCGTGGAAAAAGTTACCAAAATAAGTGATTTACTTAAAAAGCATCCCG
GTGGTCGTGGTACACTCGGATCATTCAAAGGATTAGCCTTGGACAAAATT
ATGACCGAGGTACCACATTCGGATGCCGCGTTACACCTTATGGAGGAATT
TGTCGTCGATAATCAAAGGAAATACGACGATATTGAGAACTTAATTGATT
GGAACGGACCCTGTACTCGGTCAAGTGGGAAAAATAGCCGATCGTTACTG
GGAATGGGTGAATCTTCCAGTGAATCGTTCAATGCGCCTTTTCAAGTCAG
ACTTTATGGAAAGTTTGACAATCACACCGTGGTACATGATACCAATTGTG
TGGATCCCAGCATCGATATTATTTTTGTTTCTGGGCATCAAGACAAACAA
TTCCGCAGACTTTCCTTATGCGTTTCCCGCAGTACTGTTATCAGTTGTTT
TGGGTCTTTTCAATACGTAAAATCTTGAATATTTCGATACTTTTCACCAA
TTCACTCAGCGAAGGAATAATTTTTTTTCCTTTTAGCTTATGCGTTTCCC
GCAGTACTGTTATCAGTTGTTTTGGGTCTTTTCAATTGGACTATTTTAGA
ATACGTTATACATCGAAATCTCTTCCATTTGAAGCCACCAGCAAATTCGA
GAACTCTAATCACGCTGCACTTTGTTCTTCACGGAGTTCATCATAAAGCA
CCCTTTGACGATCGAAGATTATTATTTCCACCTGTTTCCAGCCATTTTAG
TAGCTGCCATATTTTTCAAAATATACAGCGCAGTTTTACCAGATGCAATT
GTATATTTGGTTGCATCCGGCACCATGACAGGATACTTTTGTTACGACTT
AATGCATTATTATTTACATCACGGTAGTCCAAAAGCAGAATCGTATCTCT
ACGTCATGAAGCGATATCACAACCATCATCATTTTTCGCATCACGACCAG
GGTGAATGACTCATTTATTTGTTTTTTTTTGCATCCTCCAAATGCTTGAA
AATACATTTTTTTTAGCTGAACATCATGAAATTACTTTATTCAATAGAAA
TAAAAAACTTTTTTTATCGTTCTTTGAGAAACATGAAGAAGCCACAAAGA
ATTGTGTCGCACTCGAGCGACAGTTCTTGTTATTGGATGGAAACAATTTC
TCTTTGCGTGCACGTATTTCTCACTCTATTAGTTATTCTTTTTTCTGCCA
CGTAAAATGATTGATCTATTGTTGCAGTTTGTCGCTGCGTATTGATTGTA
GAGCCTGGTAAAAGTGTCGTGCATTCGAACGATTATAATGGAATTACTCA
AATTATTGTGAAATCGTCGCTTGTAAAGAATGAATGCTTTTTTTTCTTCC
AGGATTCGGGATTAGTAGCCGCTTGTGGGATTTCGTATTCGGATCATTGA
TAAAGTTGAAACAACTGAAGAAAGCGATAGTTTGGTAATAAAATCAAAGA
TCGTCACCATTTAACTCTTAATTACTCTTAACTTTATTTTTTTCAATGAA
CTATATTAATCGCATTACAATATTGAGAACGCCGTTATTGTTTTTGAATA
TTCCATACTGATTATTTTGTGAAAAAAAAAAAAAAATCAATTCCATGAAT
TTTGCAAATGCTCTGTAAACGTTTGCTCTCCTTATCGGCGGTATGGTCCC
ATCTTCGCAACTGAGATGCGCTAAACGAATGCATTCGTCGTCAACGTCAA
GAGGCGTGACAATTTTTTCGAGAAAATTTGCATAGTGAACGCAGCACAAT
AATTCTCTCGATCCTCTTTTATCAACAGGCAATTGTTAAGTACGATTAAG
CGATAACGAGACATATCAATAGTCAAGTGACAAATAATCTTGAGCTTTTT
TTCACCGGTTAAATTTACTTGCAAACATTTTTTGTTTCGCTAGGACAAAC
TTCAGACACGAGATGTACGAACATTTGAACAAACGAGTTTTTACAAATTT
GGGACGAATAATATTGATAAATTTTTTTTGGAATGTTCACGATTCATTTG
CATTTCAAGCTACTAAACAAAAAATTACATCAGTAGAATACATTTCAACT
GAGAATCAAAGACAAAAAAGATTACGACGCTGAAGTTTCCAACGTTGGAG
TCCAACGAAATGAACGAAAANNACGTT
back to top