BAP2ALocus_1058_Transcript_8/11_Confidence_0.526_Length_9162 (mRNA) Venturia canescens

Overview
NameBAP2ALocus_1058_Transcript_8/11_Confidence_0.526_Length_9162
Unique NameBAP2ALocus_1058_Transcript_8/11_Confidence_0.526_Length_9162
TypemRNA
OrganismVenturia canescens (vcanescens)
Sequence length9162
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Venturia canescens transcriptome v1.02018-05-04
Sequences
The following sequences are available for this feature:

mRNA sequence

>BAP2ALocus_1058_Transcript_8/11_Confidence_0.526_Length_9162 ID=BAP2ALocus_1058_Transcript_8/11_Confidence_0.526_Length_9162|Name=BAP2ALocus_1058_Transcript_8/11_Confidence_0.526_Length_9162|organism=Venturia canescens|type=mRNA|length=9162bp
TCCTGTAAAAATATGCATTAAAAATCATCCAAATATTCTCATCGCGATGC
AGCAGCTGAAAAATTTCTCAATCACTGACATTGCGATCGCATTTTTAGCT
GTTCTTCACTCTGTCTCGTTGTCGTCACGCGCATCATTGGTCGCTTGCAC
TCCGTTCTAGTCGTATTTCCTGTTCTGCTCTTGACGCAATTTTGATGTTT
TAACCTTTAGGACCCATTGCCTAAATTTGGAGACCCATTGCCATGGGCAT
CGTGTCCACAATTGGATGGTAAACCGGTGGACGAGTGTGCCAAGAGTTCA
GAGACAGCTTATTTCTGGTATCGCACCACCCTGGACGCTGCACCCTCGAT
CGAAGAGGGTCAGGACATCAAGTGGTGGATTGCACTTTGTTTACTGCTCA
GCTGGGTTATCGTCTTCTTCATCGTAATGAAGGGAATCCAATCCTCGGGA
AAGGTGGTCTACTTTACGTCCCTCTTCCCCTATTTGGTGCTCACAATTTT
TTTCATACGAGGAATAACGTTAAGGGGAGCTGGTTCTGGTCTTGCTCACA
TGTACACACCCAAGGTGGAAAAGCTGCTGGAACCAAGAGTTTGGCTGGAC
GCTGCGACACAAGTGTTTTATAGTTTTGGTTTGGCCTTCGGCTCGTTGAT
AGCCTTTGGGAGTTATAACACACCGGATAACAATTGCGTGCGTGACGTCA
TTCTTGTCAGTTGCTGCAACGTATTCACTGCACTGTACGCCAGTGCCGTT
GTGTTCGCGATACTCGGGTTCAAAGCCATGAGCAACGTTGACAAATGCCT
TGCCAGCAATCGAGAATTGCTCATCGATGCAGGCAATCGAGAATTGCTCA
TCGATGCAGGATTTCTCAGTGTCAATGCTACTACTGAGCAATATCAATTG
GCTGCAGAAACTTACAATACTTCGGGACAAAACTTTACCCTCGATGCTTG
CAGCATCAGCAGTCAATTGGAAAACGCCGCTGAAGGGACAGGCCTAGCTT
TCATAGTCTTTACCCAAGCAATCGTTGAACTACCTGGTGCTCCATTTTGG
TCTTGTATATTCTTCCTGATGTTATTGGCGCTTGGGATAGGCTCACAAAT
CGGAATTCTCGAGGGAATGCTGTGTGTTATTTTTGATATAGATCTTTTCA
AAAGGGTGAAAAAACAATACATTACAGGTGTTGTATGCGTCGTTTGTTTC
TTCGTTGGTCTCATATTCTGCACGGGAGCTGGTGAATACTGGCTTAAATT
ATTTGACAGTTTTGCCAGCACCATTGGGCTCGTGGTCGTCGCTCTAATGG
AAATGATTTCCGTTATCTTCATATACGGTCATGAAAAATTTTCGAAGGAC
ATTCAAGATATGACTGGTTATCGACCAGGCTGGTACTGGCAGATAACATG
GCGGTTCCTCGCGCCCCTCATCATGGTCTGCATCCTTGTTTCGAGTATGG
TTTCGATGCTAGTCAAAAGACCCGAATATTCGGCGTGGAGTGCTTCTTTG
GGGATGACTGTACAAAGAAGTTATCCCGACTGGGTGCTCGGAATTGGCAT
ATGTATTATTGTAGCCGGCGTTGCTCCGATACCTATCGTCTTCCTATTGC
GAAGATTCCAATGCGTTAAGCTCGACGTCGACATACACCAGGGCAGTATC
CGGCGGATTGACACGACGGTGTCAACCAAGGAAATGATGGGTGATGTCGA
TCTGGACGAGTATCACAGTAGACTGGAAGATTTTTCAGAAGAGGATGAGG
ACGTGAACAGCGATGACGACAACAATTCAGCACCGCAGAATCTCCAAAAG
ATGGCAGCAAATCAGCACAAGAGCAAAGGTTTCAAAATGGAAGTGATGGA
ATTCTGAGACGAGAGGAAATGAGCTCGAAATTCCGAGTTCAAACGAATCC
GCAATATCCCAATCGAGTCGGTAACTCCCCTTCGACCGTCGTCAGCGATG
ACAAAACGTTGAAAATTGATTTTTTGTATAGTTCGCAAAAACCTTTCCTC
CTCAGCGTTGTATAGATTTGCAGAAAAACGAACAAAACCAAAAACCAAAG
AATATTAAGCGAGACGAGATCGCCGGATATACATATTAATAAATCGAAAC
ACGGTTTAATTTCACCACCGAAATTTGCGATTGTAACAAGAAACCACGAA
AAAAAAACACACACACACACACAAAAAACGGATTCAAGGAATTAAACTGC
CATTCGTACGAAAGTGGCATTCGGAGGATAATATTATATTTATGTGCATA
CGTATATTGCGACGAGAACTTTTTCAACGTCACTTAAATATCTGACCTCA
CTTCTGCTCGATGCTCCGATCCCGATGCAGCTTTGCAGAGTTTCTCAGAG
CGAAAGAATGATGTTTTTTGTCTTATTCTGTAAGGAGATACGTAGCACGG
CATACCTTCACAATTTGAACTTTTTTAATGTGCTTGTCATCAAGACGTCG
AATTTCTAGATTTTCATTGGTCAAATCTCTAAAAAAAACGTACTCCGTAT
TAGGAGCCCCAGTTGAGAACTTTTTCTTTGCTCCCTGCTCCGTCCACATG
CCGAGTGTCCCCCTCAGGTGACGTTGAGCGAAGCGTTTCCGCGGGCACTG
CAAAAAATTAATTTTACTCTGTTTCCAAATCAAGTAGCGGCTTAACCTCG
GTTGCAAAATTAAGGTCGTGTCCTGCTATGGATATCTGGCATTCTGTTTT
TGTTTTTTTTGACTTCTTTCAAATATTTTCCCATGCAATAAGGCTCAATT
TTTCGTCTAACATCGACCTCGTCTATTCCGCTGCAAGGAAATTGGTCAAC
TGTTGTTTTTTCTCTACCGTGTCGTGTTGATTCGACATTCAAATGGAAGC
ATGAGGAATCGAGCATTACGAGGGAGAGGTCGAATTTCAATGGCGCAAAG
TACAATTTTTCGTCGCAATATGCGCGTAAATATGTAGATAAAATTGGGCA
GTATAGAATCGTAGTATTAGTGGGACGAGCCTCGATGACCTTTTTCGTTC
CTTTCATTAAGAAGTCATTCTCGTCGATGGTAAATAGTCGATATTTTGAG
ACAAATAGTAATTGATGCTCGTGTTCATCAACTTACGAGATGTGGGTGTA
GGACGAAATAATGGATTTCATTTGAAATAATTTTATCATTACTTTTAAGA
TCCCGAAAAAGCAACAGCAGGATAATTATCGCTGAAAGACACAAACAAAA
GAATGAAAACGAGTTTGTGGCGCCATGAGAATGATTATAGTCTACGTTCG
CGTCCGCGAAAATCAGTCGGTACAAATTTCATATTTTACAAAAAGGGGAA
CCTCAGCGATTAGACAGAAGAAGAAAAATTAAACTTGTTTTTTCGCTCTA
AAATAAATCTATCGAGATTGACTCAGCTGCGATCATTGTTCGGCTGGTTC
ACCCTAAGATAACGAAAAACAAACAATAATAAATAATAACAATTGATCGC
GATTGTTCTCGCGTAAGGGTGACCAACGAGGCTCGAAAACGAAGCGATTA
ATACCTTTTTTTCGCTATTTGGTTCATTCTCATTTGAGTTGTTCATTCTA
TTCGGTTATCTTAACGTCGTTTTTATTCTAACTGAAGAACGGTTTTTTTT
ACACTATCATGTCGAATATATATCGCACCGATACCCGAGAGTACAAAGAG
ATCGATCAAATCTGAGATTAAGTGAATGTGGTTGCGTTTTTTCATGGATT
AAAGCCAGAAACGCATCGATTCGAAAGCAAAGGAAAAATCACTTATGCTA
AGCTCTTCCGCCCCCTTTTTATTTATGCTTCATGGGCATGCTTGTGTTAC
CGACGTTATCAAGAAAAACTTAGAAATTCATATATTTGGTATCTACATCG
CGCTACGTTAAACATAAGTGTTGTTGAGATCAATAGCACTATCGCATTAA
TATCCTCGGAAACTATGTTATAGATTAAAACATAATCGTTGCACTCCAAC
GGCGTGTGGAGCATGTTCCACGAACTTTGTTATTTTTTTTTCTCAAATCT
TTTTTCAACCCTAAAAACTGTACAAATTGAATTTCCACACGAAATTATTT
TCATCCTCAAAAAATGTGCCCTCGTTTTATTTCGATAAAGCTCCATAATG
ATTTCGACTACGAGTTTTGTAACGAACTCTCAACATTGTTATTGGCCCTA
GGTTACAAAATGTTCAAACAACGTAGCGTTAACCCGCAGACACCACACTG
GTGCAAATTTGCACCAGTGAAACTTATCATTTCATCCATGAACGCATGGA
ATCTAGAGTCGCGGTAGCGACTCTGAGACAAGTACATTTACGTATGACGA
GTCGCTTCCAGAGAGTCTTTACAGGAGCGAGAATGTTTTTCAGCTGTTTT
CGATAACTTTCGAAATTTATTTCTTTAATGATTTAATAATTATAGTGTTT
CAGTGAATTCTGCAAGATGACGTATTTTTTATTTTTTTTTATCTGTCGAT
CGCAACCTCTACGAACTCTGTAGCTTAACGTATTGAAAAGATATTAATTA
TTTATTTTTTAATTTCATCAAAAAATGTTGCATTTTTTCGCACACATTTT
TGATGTTTATTCGTTTTTTCTTTAGTGACAAATCTGGTGCCATAATACAA
ATTGTATACCTATATATTTCCATGAATCTGTTCATGCTTCAAAAATTTGG
AAAGTGACAGTTCCCAGGTTGTATTCAAAATTTAAGCTGTCAATTTCACG
AAATGTTATCGAATCATTCAGAGATTAAAGGATACCACATGTTCGTTTTA
CCAAGAAATCTGAGTCACGTATTGTGGCCGAATCTTTTTTTTAATGTTCT
TTTAGTCGGTGTGATGCTATCGTTTAATGTTCTTGGATTAAAGGATATGT
GACATACCACATGTTCGTTTTACCAAGAAATCTGAGTCACGTATTGTCGC
CCAATCTTTTTTTTAATGTTCTTTTAGTAGGTATGATGCTATCGAGTAAA
TCGTTGGGTTGGGCTTTTTTTTACTCGTGCTCATCGTTGATGATAAGCAT
TGGAGTGAATTTAAGTGAAGAATGCGCCAAATGTACATTCGTACATTCTT
TATTTTTTGTATGAGCAAAGCTTGCACGAAAAAAATAATTACGCTCGTCA
TCGTACGAGGTTAGAATGATGTGTCGGTGCATACGCAGTAGAGAAGCGAT
CTCGACCCCTTTTCACCAAGGGCACAAGCAAAATCCATCTCTCGTCGGTG
GCTTGATAGTTTTCACCAGTAAAACGCCAAGTACAACGGCCAAATGTTTT
TTGTTTCAATTTTTTGGTATATAATTTTTTCCGTGGGTAATTTTTTTTTA
ATTTTTATGATCTTAATTTTTTTTAGTCGCAATTTGTTTTTGTATGTTTT
GTCTTTGTATTTTTTGTGGTTGTAATTTTTTGTGTCCTATTTTTCTTCTT
TTGTAATTCTTTTGTTCGTAGTGCGATTTGCTCGGCAACTTCTGCATTTA
TTTGACAACGTTTTGTTTCTTGGATTTAAAGTTTTACGACCATTGATTTC
CATGTTTCTACAGATGACTTCCCAGAGGGCGTAAATGTACTTGTCTCTAG
TTTTTAATCTTACAACGAGACATTTTAGGGGTAACAACTGTTAGTAATCG
ATTACAATCATTAAAAAAATTGAAATTGATTCTGAAGTTCTAAACACTTG
AAATTTTCGTGGGTGCAAATTTGCACCATTGTGGTGTCTACGGGATAAAA
CTCCGGAAAACATAAATAAATAATATTGACGTCAAAAATGATTTTTCAAA
TGGAACTGCAAAAGGTCTGGTTGATCATTCGTAAAAAAGAATTGACATTA
GTTGACAAGCCCAGCTTCATACATGAATTATACATATGCATATTGCATAC
CTGTACAATAGCATTGTTATTATCGTATTTTATATTGCATTGCTGAGATA
TAAATTGGCGAATGGGTTTGTTTTCTTCCCCGTTGGTCATCCTAAATTAG
CTGTACCTAATGTACATACGTAAAAAATAAGTTTAGACGTATAAGTTCGG
CGGATTATTGTGTGTACTAATCTGTGAGAAAAGTGAGATTGAGAGAGAGA
GAGAGAGAGAGAGAGGGTGAAAGAAATAATTAAAAGTTAATTATTCACGG
TAGCTCAAAGAACCGTCACGAAGAGCTTCCGCGTGCGATTCGGAGGAAAG
ATTTATGTATTCCTATGTGAGTATTGTAAAAAATACGAGAACGAATTGAA
GCGATATTTGCAACGTTGTTAGTTACGTTAATTGAGACTATTGTCGGGAG
CAAGGGCGACAATTTGTAAATATTAATTAGGCGAATTATTAGCCAAACGC
GTTCCAAATTATTTATTGATTACCAATCATCCTCCTGAAATGATGCATGA
GTTATATTATTTTTATTTCGTTATTGTTAAACATTATTATTGTTACCATT
ATCCATACGATTGGTTCAAATCATGCGCAGATCAACTGCAGATGGCATCG
AAGTACCAGAGAAAATTTGAAATTTTTCTTAGAGACTCCAGCGGGAAATC
TGGAAATATTAGCTGGAAATTCATTTTTTTCTCTTTCCAAAATAAGTTGT
ACGACAAATAAAGTTCGCAACCGCTTGATTAACTTTCTCAAACACAATGA
AAATCGCGTTCAATTCACCCCAATATTGGACTTATTCCCGAAATTACACT
ACCCGATTCCATCATTGGTTCAATGAAATATTACGTTTATTTGGAAATCC
CAGTGCCAGAATATCAGTGCCAGAATATCAGCCGCATCTGTGTCCATAGT
TTTTTTTTTGCGAAAACGGAGCCCTGGGAATCCGAGGAAAGACGAGAGAT
GATCGAGTTATGCTTCGAGTGTATGGATTTTGCTGCCAGATTTTCATGCC
TATATTGATGAAAAAGTACCGGGAGTGTGGAGATGAGAGCCAGGAAAAAT
CGTTAGAACCGAGTGAAATACAAGGATAAGAAAAACTGAAAATTTTTGGG
CTATTTTCGAGAATGGGGCTGCAAGGAAGTAACTCACCGGCACAACGACA
CGAAGATCGATCAGACTGCGATCAGAAGAGACGAAATCTCGAAGCAGAGT
CCAATGATCCCGAAATGGACAGTAATACGACAGATGTGCACATCCGATTG
CACAATGATAATAACTTGTTTAGTAATGAAAAAGAAAAAGCAGAATTTTT
TGTTAGATATCGTGGAAAAAGTTACCAAAATAAGTGATTTACTTAAAAAG
CATCCCGGTGGTCGTGGTACACTCGGATCATTCAAAGGATTAGCCTTGGA
CAAAATTATGACCGAGGTACCACATTCGGATGCCGCGTTACACCTTATGG
AGGAATTTGTCGTCGATAATCAAAGGAAATACGACGATATTGAGAACTTA
ATTGATTGGAACGGACCCTGTACTCGGTCAAGTGGGAAAAATAGCCGATC
GTTACTGGGAATGGGTGAATCTTCCAGTGAATCGTTCAATGCGCCTTTTC
AAGTCAGACTTTATGGAAAGTTTGACAATCACACCGTGGTACATGATACC
AATTGTGTGGATCCCAGCATCGATATTATTTTTGTTTCTGGGCATCAAGA
CAAACAATTCCGCAGACTTTCCTTATGCGTTTCCCGCAGTACTGTTATCA
GTTGTTTTGGGTCTTTTCAATTGGACTATTTTAGAATACGTTATACATCG
AAATCTCTTCCATTTGAAGCCACCAGCAAATTCGAGAACTCTAATCACGC
TGCACTTTGTTCTTCACGGAGTTCATCATAAAGCACCCTTTGACGATCGA
AGATTATTATTTCCACCTGTTTCCAGCCATTTTAGTAGCTGCCATATTTT
TCAAAATATACAGCGCAGTTTTACCAGATGCAATTGTATATTTGGTTGCA
TCCGGCACCATGACAGGATACTTTTGTTACGACTTAATGCATTATTATTT
ACATCACGGTAGTCCAAAAGCAGAATCGTATCTCTACGTCATGAAGCGAT
ATCACAACCATCATCATTTTTCGCATCACGACCAGGGTGAATGACTCATT
TATTTGTTTTTTTTTGCATCCTCCAAATGCTTGAAAATACATTTTTTTTA
GCTGAACATCATGAAATTACTTTATTCAATAGAAATAAAAAACTTTTTTT
ATCGTTCTTTGAGAAACATGAAGAAGCCACAAAGAATTGTGTCGCACTCG
AGCGACAGTTCTTGTTATTGGATGGAAACAATTTCTCTTTGCGTGCACGT
ATTTCTCACTCTATTAGTTATTCTTTTTTCTGCCACGTAAAATGATTGAT
CTATTGTTGCAGTTTGTCGCTGCGTATTGATTGTAGAGCCTGGTAAAAGT
GTCGTGCATTCGAACGATTATAATGGAATTACTCAAATTATTGTGAAATC
GTCGCTTGTAAAGAATGAATGCTTTTTTTTCTTCCAGGATTCGGGATTAG
TAGCCGCTTGTGGGATTTCGTATTCGGATCATTGATAAAGTTGAAACAAC
TGAAGAAAGCGATAGTTTGGTAATAAAATCAAAGATCGTCACCATTTAAC
TCTTAATTACTCTTAACTTTATTTTTTTCAATGAACTATATTAATCGCAT
TACAATATTGAGAACGCCGTTATTGTTTTTGAATATTCCATACTGATTAT
TTTGTGAAAAAAAAAAAAAAATCAATTCCATGAATTTTGCAAATGCTCTG
TAAACGTTTGCTCTCCTTATCGGCGGTATGGTCCCATCTTCGCAACTGAG
ATGCGCTAAACGAATGCATTCGTCGTCAACGTCAAGAGGCGTGACAATTT
TTTCGAGAAAATTTGCATAGTGAACGCAGCACAATAATTCTCTCGATCCT
CTTTTATCAACAGGCAATTGTTAAGTACGATTAAGCGATAACGAGACATA
TCAATAGTCAAGTGACAAATAATCTTGAGCTTTTTTTCACCGGTTAAATT
TACTTGCAAACATTTTTTGTTTCGCTAGGACAAACTTCAGACACGAGATG
TACGAACATTTGAACAAACGAGTTTTTACAAATTTGGGACGAATAATATT
GATAAATTTTTTTTGGAATGTTCACGATTCATTTGCATTTCAAGCTACTA
AACAAAAAATTACATCAGTAGAATACATTTCAACTGAGAATCAAAGACAA
AAAAGATTACGACGCTGAAGTTTCCAACGTTGGAGTCCAACGAAATGAAC
GAAAANNACGTT
back to top