BAP2ALocus_1058_Transcript_9/11_Confidence_0.289_Length_2405 (mRNA) Venturia canescens

Overview
NameBAP2ALocus_1058_Transcript_9/11_Confidence_0.289_Length_2405
Unique NameBAP2ALocus_1058_Transcript_9/11_Confidence_0.289_Length_2405
TypemRNA
OrganismVenturia canescens (vcanescens)
Sequence length2405
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Venturia canescens transcriptome v1.02018-05-04
Sequences
The following sequences are available for this feature:

mRNA sequence

>BAP2ALocus_1058_Transcript_9/11_Confidence_0.289_Length_2405 ID=BAP2ALocus_1058_Transcript_9/11_Confidence_0.289_Length_2405|Name=BAP2ALocus_1058_Transcript_9/11_Confidence_0.289_Length_2405|organism=Venturia canescens|type=mRNA|length=2405bp
GATTTATTTATTTTTATCATTAATAAATCGGTTGTGGAGTTTATGGAAAT
TTATGCTTCGAGTGAATGGATTTTGCTGCCAGATTTTCATGCCTATATTG
ATGAAAAAGTACCGGGAGTGTGGAGATGAGAGCCAGGAAAAATCGTTAGA
ACCGAGTGAAATACAAGGATAAGAAAAACTGAAAATTTTTGGGCTATTTT
CGAGAATGGGGCTGCAAGGAAGTAACTCACCGGCACAACGACACGAAGAT
CGATCAGACTGCGATCAGAAGAGACGAAATCTCGAAGCAGAGTCCAATGA
TCCCGAAATGGACAGTAATACGACAGATGTGCACATCCGATTGCACAATG
ATAATAACTTGTTTAGTAATGAAAAAGAAAAAGCAGAATTTTTTGTTAGA
TATCGTGGAAAAAGTTACCAAAATAAGTGATTTACTTAAAAAGCATCCCG
GTGGTCGTGGTACACTCGGATCATTCAAAGGATTAGCCTTGGACAAAATT
ATGACCGAGGTACCACATTCGGATGCCGCGTTACACCTTATGGAGGAATT
TGTCGTCGATAATCAAAGGAAATACGACGATATTGAGAACTTAATTGATT
GGAACGGACCCTGTACTCGGTCAAGTGGGAAAAATAGCCGATCGTTACTG
GGAATGGGTGAATCTTCCAGTGAATCGTTCAATGCGCCTTTTCAAGTCAG
ACTTTATGGAAAGTTTGACAATCACACCGTGGTACATGATACCAATTGTG
TGGATCCCAGCATCGATATTATTTTTGTTTCTGGGCATCAAGACAAACAA
TTCCGCAGACTTTCCTTATGCGTTTCCCGCAGTACTGTTATCAGTTGTTT
TGGGTCTTTTCAATTGGACTATTTTAGAATACGTTATACATCGAAATCTC
TTCCATTTGAAGCCACCAGCAAATTCGAGAACTCTAATCACGCTGCACTT
TGTTCTTCACGGAGTTCATCATAAAGCACCCTTTGACGATCGAAGATTAT
TATTTCCACCTGTTTCCAGCCATTTTAGTAGCTGCCATATTTTTCAAAAT
ATACAGCGCAGTTTTACCAGATGCAATTGTATATTTGGTTGCATCCGGCA
CCATGACAGGATACTTTTGTTACGACTTAATGCATTATTATTTACATCAC
GGTAGTCCAAAAGCAGAATCGTATCTCTACGTCATGAAGCGATATCACAA
CCATCATCATTTTTCGCATCACGACCAGGGTGAATGACTCATTTATTTGT
TTTTTTTTGCATCCTCCAAATGCTTGAAAATACATTTTTTTTAGCTGAAC
ATCATGAAATTACTTTATTCAATAGAAATAAAAAACTTTTTTTATCGTTC
TTTGAGAAACATGAAGAAGCCACAAAGAATTGTGTCGCACTCGAGCGACA
GTTCTTGTTATTGGATGGAAACAATTTCTCTTTGCGTGCACGTATTTCTC
ACTCTATTAGTTATTCTTTTTTCTGCCACGTAAAATGATTGATCTATTGT
TGCAGTTTGTCGCTGCGTATTGATTGTAGAGCCTGGTAAAAGTGTCGTGC
ATTCGAACGATTATAATGGAATTACTCAAATTATTGTGAAATCGTCGCTT
GTAAAGAATGAATGCTTTTTTTTCTTCCAGGATTCGGGATTAGTAGCCGC
TTGTGGGATTTCGTATTCGGATCATTGATAAAGTTGAAACAACTGAAGAA
AGCGATAGTTTGGTAATAAAATCAAAGATCGTCACCATTTAACTCTTAAT
TACTCTTAACTTTATTTTTTTCAATGAACTATATTAATCGCATTACAATA
TTGAGAACGCCGTTATTGTTTTTGAATATTCCATACTGATTATTTTGTGA
AAAAAAAAAAAAAATCAATTCCATGAATTTTGCAAATGCTCTGTAAACGT
TTGCTCTCCTTATCGGCGGTATGGTCCCATCTTCGCAACTGAGATGCGCT
AAACGAATGCATTCGTCGTCAACGTCAAGAGGCGTGACAATTTTTTCGAG
AAAATTTGCATAGTGAACGCAGCACAATAATTCTCTCGATCCTCTTTTAT
CAACAGGCAATTGTTAAGTACGATTAAGCGATAACGAGACATATCAATAG
TCAAGTGACAAATAATCTTGAGCTTTTTTTCACCGGTTAAATTTACTTGC
AAACATTTTTTGTTTCGCTAGGACAAACTTCAGACACGAGATGTACGAAC
ATTTGAACAAACGAGTTTTTACAAATTTGGGACGAATAATATTGATAAAT
TTTTTTTGGAATGTTCACGATTCATTTGCATTTCAAGCTACTAAACAAAA
AATTACATCAGTAGAATACATTTCAACTGAGAATCAAAGACAAAAAAGAT
TACGACGCTGAAGTTTCCAACGTTGGAGTCCAACGAAATGAACGAAAANN
ACGTT
back to top