BAP2ALocus_1059_Transcript_2/2_Confidence_0.833_Length_5017 (mRNA) Venturia canescens

Overview
NameBAP2ALocus_1059_Transcript_2/2_Confidence_0.833_Length_5017
Unique NameBAP2ALocus_1059_Transcript_2/2_Confidence_0.833_Length_5017
TypemRNA
OrganismVenturia canescens (vcanescens)
Sequence length5017
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Venturia canescens transcriptome v1.02018-05-04
Sequences
The following sequences are available for this feature:

mRNA sequence

>BAP2ALocus_1059_Transcript_2/2_Confidence_0.833_Length_5017 ID=BAP2ALocus_1059_Transcript_2/2_Confidence_0.833_Length_5017|Name=BAP2ALocus_1059_Transcript_2/2_Confidence_0.833_Length_5017|organism=Venturia canescens|type=mRNA|length=5017bp
GGGGAAACTTTTCTTCGTATTATTACAAATATTACAACAAAAAAAAATAT
TCTGCATCAATAATTTTACAACTTACGGACCGACAGTTTTCATCGGCATC
GCACTTTCAAACTCGCATTCGTTATCATGTGCGTAACACGCATTTTCGTC
TCAGTCATATTTTCTTTCAATTTCCTTCTCCTTAATAATAAATTAATAAT
TAAAAATCAATAATAATAATAATATTAACAATAATAATAATAATAACAAA
CATTTTCATTATCGATTCGTTCTTCCGGTGGGCCATCCCATCCAAAATAG
CGATTACGTGTTTGTAGCAGTGACGAAACGCACAAAAAAAAATAACGTCT
AGGTCAAGTGTCGTTTCACGAGGAAAAGTCTCGTTGTGTTGTGTATGCTC
GTGTGTGCGTGTGGATGTGTGCGTGTGTCTCCTGTAATATCAACGTCATT
GAGAGTTTTACCGAGCGAACACTGATCCGATTATTGTGAACATACTTTAA
AAGTCACCCCTGTAGTGTGTACCGTACGATATTCGAATGGAAAAATAAGA
CAAAAATCACAGAGCGAATCTCGCTGGAAGCTTCAACAACTTTGAAAAAG
GATCCGCGCGTGATGGACAAACAAGGCGCGCAACTCTCGAGCCCAATGTC
TTGCGAGAATTCCCGCAAAGGGAATAAAACAAATGAAATAAATTAAAAAA
ATTAGCGACAAATAGATTTACGAAATCGAAATAGTGTTTATTGATTACGA
TAATAATAAATTATGTTAACGATACTGATAAAGGAGAAAATAAACGAGAA
ATAAAATATGGAATATTTAAAATAACCATAGAAATATCGTCGTCGATGAG
GTCAAAGAAATAAGAGATCCATGCAGTTAACGAATGATTATTATAAGTTA
ATGAATATTTATTGTTAGGCACACAGTTATTATGTATACCTCGTGAAAAT
TTGTTAAATATGTATACTACATTACAAAAGCAAAAGAAAAAAAAAAAAAA
ACAAAAGAAAATGAATGAGAAAGGAAATATCTGTCTTTCCAATGGTGTAT
AACGAGAGAAGAAGAAAAGAGACATTACTTGCTGCTTGGTTTTTGTAAAC
ATGCTTTTCAATGAAAAAAAGCATAATGGAAGAATAAAACTTGTTGTCGT
AGAGAATCGTCTTATTTCTGCAAGGTTGGTCAATGAGTGATTAATGATTA
TTGACATGCGAGACACGTTTTTTTTTTGACTATTTTTCAAGATATTAAAT
ATCGAACTTTTTCTGCAAAAAAAGAAATATCAATAACTTTTGCTTCTTTT
TTTTGGCTTAGAAAAATTATTCAAATTTCATTAACAGTGGAAAAACTTTC
GAAATTACGAATCGGCGTCGTTGTTTCAAGATGCCGCAAATTTCGATTCG
AGAGAGTATTGAATTTTTTCGTATGTGACTGTGAATCGGAATGTTAAAAA
TCTACTTAGTGCGATGTCGAAGCAATTGAAAATCGATAATTGGGTTAACT
ACGATGGCCATTTTTAAGCGGTTACGCGAATCAAGAGATAATGCCACTAC
GCAGGGAGATCTTTGGGGGTTTGTGAATCTTGTATCTCGGCATCTCGTAA
CGTCGTTGTGTTGCCTTCGGATATTGGATTGTTCGGAAGCGACGTTATAA
ACGACACGGAAGCGTTAGCTTTAGCTTCCAAGAGTGCTGTTACGTAGCCA
ACTTTTTTCAGGCTCTCGTAATTTTTCGCCTTGAAACTCTGGAAGTCCTC
AATATCTTTTTCGCCGGCGAAACCAGTGGATGAAGCATCCAAAAAGGCTG
TAACAACCTTACAGGACTTGGGATACCTTCTAGTGATGTTTTTCCAATTG
CTCTGGACAAACTTAAGGGCAGCTTGGGTAGCAGCTGGATAAATGGAGAA
GCTGTCGAGTATCACGAGAGCGTCCTTTTCGTCGAAGCTATTGCTGTAAA
CTATCTCGTTGAGGACAGCCTGCAGCAATGACGGCACTTGGAAACAAGCC
AACGAAGATAACAATGAATTTCTCTCATTCCTGGTCGTAACGTTGCTGAA
CTTTTGCTCCCACCATTGCCAGCTCAACTCGCCATTTAATTTTGCAAAAG
CGCAAAGCAGACTGCTGCGCAAATAACTTGGTACATTTTTTTTTATTGGC
AACTCTGGTAAGCGCTCAAAACCAGCATAATGTCTCTTGGCCCAGGTGAG
GTAAGCTGGACAACTGAACATGCAGGCCAATTGATGGGAGATCATTGTTA
ACCGAGAACCTTCTTCGATTTTCTGACCGACTCGGTTAAAGAGTGGTGAA
ACGAACGTCAGCATACGTTCCTGGTATTCGGAGTATTCCGGGCTGTCATA
AAGAACGAGATTCAACTTAATCGCGTGCTGCAGCAAATAAGCCCATGGCT
CAGGTTCCTGCTCATTTTCCGGGAGATATTGGATGACATCGAAAACAACG
GAGTAAGGAATGGAGCGAACGAAAGCAGCGCTAAATAGGTCATCGACCAG
CGAGGCTCTCGTTACCGGCGAAAATTTGGAGTGATTCTCTCGCAACGCTG
CAGCGATCAACTTCCAATTCTCTTGATCGTAATTAACGCGATAATATCCC
GACTTCGATGGGTTGAAAACAAACCATGTTTCATTGTTTGTTTCGTTAGC
AGCAACACTTTGAAGCTCCAACGTAGTTTCAGCCTGATTTTTAATCCATT
TCAAAGTAGCATTGGAATTTTTATCGCTTATCCAAGTCAACGGTATGTGC
CACAGTTGTTGGCTTGCCGAGGAAAGCTTGTCGTAGCTGAAGCGAGCCTG
ATGCACGATTGCCGATCCAGTTTCATAGTTTCGCGTAACAGTGACGAGCG
GATATCCTCCTGCCGTGCTCCAAAGATTCATAATTTCCGGTAAATTAACG
TCGCCTTCCGGCTTTTCATCGGCTGTCGAATTTACGGTCATGGCTTTCCA
GAAGGATATGACATCGGCATTGCCGCCAGACCACCTTGAAACGAAAGATA
GGTATCCGGCACGAAATTCCATCGAGCTTAATGCGCCATGCAACATGTTA
ATCAGACATGCACCGATCGCGTAAGCCTCCGATGTGTAGTAGGAATTTGA
ATGTGTAGGTTCGAGTTTCGATGTAAGAGATCTCGCGACGCTGTACCCAG
CAACCTCGAATGCATCCGGTTGAACGTCCATGACAAGAGTAGAATGATTA
AATTCCGCGTCAATATCCTTCGCGAGACGATGCTGAAGATACAAAAGTGA
ACTTTCGAGGATCCAATTGTCAGAAGAATTTTGGCTGTTGACCACTCCAC
CGAGCCACTGTTTCCCCAACAAATTTATTAGACTCATGAGAGCGAGCTCT
TTCGTCACTTTGGATGAGTTATTTTTCACTGCATACAAAGCTTCTTGAAC
CATAATGAGACCTGGATAAGAAGAATCATAGTCACTAAGACGCTCCGAAA
TTATGTCTAATTTTGGTATCGAAATATTAACACCAAAAAGAGTTGCAAGA
TTCGTATAAACGGACTCGATTTTATTCACTAAATACTGCGCCCCGCCAGG
CTGCAACTTTTCACCCCAAAAGTCCATCGTCACGTTTCCAATTGTCTTTT
TACCCAGACTTTGAACTTGTCCTCCCGCTACTGCGACTACATTTTCGGGA
GACATCGGCGGTGTTTCCTCGAACGTGTCCGAAACCCAGTCGTTCGACAG
TTTCGAAGAATTTTTCAAAGGCATGTTTGTGTAAATCTTCATGGTGAATG
GACGTGGGAGATTGAATTGAAATCGAGCCTTCATTTTGACGTCATTGAAG
GCCGGAAAAACGTCCAGGAGGCTTGTGGGTTGCATTCGAGAAGCTCCGAC
CCACTTTTCAATACTATTCTCGCTATTATTCCTGGCGTAAACAACGTAAT
TGGTAATGGGAACTTCGTAGTTGAGTATCAAGTGGTATTCCCCTGATTTT
ATTGCTTTCTCGGGATACAGCACTAGAAATCCAGCTTTTTCGTCCGTTTC
ATTTCTGTTTATTGCAATTTTCCTTGTTTCATTTTTAACCGATGACTCGG
TTGTGGAAGATTCAGTCAAAGGTGTGACTGTTGCCTCGGTGGTGTTGGCA
GAAACCTCGAATGCTTTCATTTCGGTAGACGAGTTCTGCACTTGGGCGGC
ATGAGTCGTGGTTTCATTCGAAGCGTTTTTCTGCCCCAAACTTGATGCGT
CAGCTGCAACGTTTGCTGTTAAATTTTGGGCTCGACTATCGTCCGCTTTT
GATGAGGTTGAGTTCCCAACGATTTCCGTGTCATTGCTCGTCGCCGACCT
TTTTCTCCGCGATTTGAAATCTTCGGAATTTGTTGTTTTGCCAGAGACCA
ACGTTGCGCTGGTCAAATTAACGTTTTTGGCGTTCAGCACGAGCTGGGGC
AAACTCGAGCTTCCATTGTACTGAAATTCTATCGTGACATGTCCCCGCAG
TTTGGTGACTGTATTGCCCTCGATAATCGGCGAAAGCTCGACTCGATAAC
GAGAGGGCGACAGCGACTTGGAAAGCGAAAATTTAGATGACACGACGTGA
TCGCATCCAACGTCGCTCTCGATCAGAGCTAATGTGTCGTAAACCTTTTC
TTTTGGAATGGATCCAATATAAGCACCGACAAAGCCGGCAGCAATGATGA
TTACAACGAAGGCACTTATAACGAATGCTGTTTTCTTATGAGACATAAAA
AATCCACCTTTTCTCTCGTATTCAATGTCGTTTAAGCCGAGATCGCTTGT
CATGAATTCTGATCGGCTGTTGCCAAATTGTGCCATGTTCGAGGATTGCC
TCCGAGCCAAAGGCTCCCACGTTTGTACCGACCCTCGTCTCATCTTCTAC
GATTTTTTAAAATCCTTCGAATATTCTTAAATGGAAGAAAAATCGTTAAA
AATTCAATAAATTCGGTGTAACAATTGACACTCAACGAAAACCGAATTTT
AACACTGTTTTTCTTTAACAGGAAACGTTTCAGCCTGAAAACGCTCACGC
GACTACGTGACTTTTCA
back to top