BAP2ALocus_105_Transcript_3/5_Confidence_0.667_Length_3122 (mRNA) Venturia canescens

Overview
NameBAP2ALocus_105_Transcript_3/5_Confidence_0.667_Length_3122
Unique NameBAP2ALocus_105_Transcript_3/5_Confidence_0.667_Length_3122
TypemRNA
OrganismVenturia canescens (vcanescens)
Sequence length3122
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Venturia canescens transcriptome v1.02018-05-04
Sequences
The following sequences are available for this feature:

mRNA sequence

>BAP2ALocus_105_Transcript_3/5_Confidence_0.667_Length_3122 ID=BAP2ALocus_105_Transcript_3/5_Confidence_0.667_Length_3122|Name=BAP2ALocus_105_Transcript_3/5_Confidence_0.667_Length_3122|organism=Venturia canescens|type=mRNA|length=3122bp
CGGAATGGGTGACTATAATCTCGGTGGTTTCGGCGGTCCCGGCGAGAATG
ATCAGAACGAGTCAGCTGCCATTTTGAAGATCAAGGAGAGCATGCAAGAA
GAGGCCAAGAGGTTTGAGAAGGACTCGGACCATCCGGATTATTTCATGCA
ATAACTCGTCCCCGTGTCGTCGGACCGAGCGACACACGTGACGAACGCTT
ACGCGGATCTGTGACCAAAAACAAGAAGCAAATCGACACACACACACACA
TGCATACACGAGAAATAGACACACACACACACACACGGAGGAGGATTAAA
AGACACCGGAGGAGAGTAGAGCCGAGGGAGGGGGCTGAAATCGTCCGATG
AAAATACGTAGCTCGGACTACGTAAAGAGCAAGAAAATGAGAAGAGCGTT
TAAAACAAAGATTGGGATAAACGAGAGAAAGAGAGAAACGATTTCGTAAA
ACTTTCCACGATCGCGCCTCGCACTTCTTCCTTCGTCGCGATCGATCTCC
GATTTTTCTTACACGATAATATTTATACGAGTGTTGTGTGCGTGGGTTCG
CCTCCGCCCCTGAATGTGCTCTGTGTATGTGTGTGTATATATACGCGCAA
CGACAAAATTCAATTGCGAATGGGGAATTGCGCAAGCGACTCGCCTGGTG
CGACGTCACTTCTCGCCTCCCAATTTTACAATATTGGCCCCTCTACGACT
AATGGTCGAATGAAAAGCCAGCTCGCGAGAGAACAATTCGAAAAATCTTG
ACGCGACTAAACTGAATGAAATTTATTTCACATTTTATATTTGTCCGTTT
ATCAACTTTTGGAATTCATCGTCCGACATTGAAATACTGCGGGGATTATA
TCATGGATGGGACAAATAAAAATTTATCGGGAGTGGAAAATTGACGCGAA
TAATCGAGAATAAAAATATTTCGGTTGCCAATATTTTTCGTTGGAAAAAA
AATATATTTATGAATTACGTGTTCATTAATTTATCAATAAATTCCATTAT
TCTTCATTCATAGCGATGAAATTAAAGAAGAATTTATTTAGCTTCGAGTT
TTTTGAGGCTCGAGATGAAATATTGGGATTGTAAATCGAGAGAATATCGA
TTATACCAATATTCGGGGTTCGATACGAATGAATTAACATGCGCACTGTG
TGTGCGTGTAGTTAGAAATATACACATGTATACATGGAAAGAAAATGACC
CATACGCACACGCGAATAGAAATTTTTCTTCCCCCGCAAGTAATGAAAAA
ATAATGTTTCACAGTTTGGATGAGAAAAAGGTGATAAAGAGAAGCCCGAT
CCAAGCGCATCGCGCAAAACTACGTGGCGGAATATCGGCGTCGAAGTTTG
CGTCTCTGAAATGCAACAGTTTTTCTTACAATATTAGGTGTACGAAATTT
TTATATGCGTATTAGAGTCACGCAGAAGTCGTTGATTTTGGAATAATTGA
AAAGTCGAAAGAAAAATTCGTTGCACTTTGTCGTCGCGAACTGTCGAGCA
TCGTACTCGTTTTCTCACGTACCGGCGTTCTTTCTTCCGTTCTATCTTAG
GAGACTATCAGTCAGGAGTGAACGAAAGAGAAATTGAAGGAGCGAGAGGG
ATGAGAAACATTGAGGAAGAGAGAGGACGACACGCGAAGGAAAGTGCACA
GGGTTCTCGCTGCTTTTCAGCAAAGATCCTTTTTTGTAGCCGTACCTATC
TGGGCAAGGGTGAAAAAAAGATTTGGGCTCGATTCGTGCCAAGTGTCGAG
AGAGCGAATCCTTGACGAGGGTAGAACTTTCTCTTTCTCTCTTCCGCTGT
CCTGTCTCTCGAGTTTCCTCGTTCTTTCATCACCTCCCTTCTTTCCTGTC
TTCTTTTTTCGGGGACGGGTGAGGAAAAAAAGAGATGAAAAAAATTGGCC
AGTGTTGCGGATAAAACCGCGTCAGGACGAGCTGAATTCTCAGCGATGCG
AGAGAATAAGAATGAGACGAAAGTCAATGCGAGATCGAGACCTCGACGGC
GAAAGAAAACATTCGTAAAATACTTATTCTCGATTTCCCTGTTCAACGTA
AAGTCTCGATTTTTTTTAGTCATCCATTTTAAGTTGACTTCCACTAAAAT
CCCTCGAAACAGGAACCGCTAATTTGTCGTTTCTTTGTGAAATTATTTTC
GGGCGTCCGAGCTAAACGAAGGAAATTTTCGAACGACTGCGAAACGAAAA
TGTTGCTTCTTCAACATTCATCGATCATCAATATTACTATTATTATTATA
TTATTACTATTATTATAATATTATCATTATTATTATCATCGTTACGATAA
ATGAAAATAACGGCGAAAAGGAAAGATCGGGCGAGACTCACGTTTTTTAA
TATTAGAAAATTTTGATCGAGAATTGTGTAAATTATTCCAGGGCATTCGC
AAATCAATTTAGGATGTGAAGTAAATATTATTATTATTATTTTATTATCT
CGGTTAATCGTTAAACAGTGTATTGTTGATAAGGGGGCCAAAGATTGGTA
GTCGATCGGTCGAGCAAAAATATCGCTCGATCGAACGCCAGTTAGATACG
GTATTTTTCTTTTCTTTTTTTTCCCTTTTTTTTCCTGTTTTATTTTCTCT
TCTTCGTCGACTAGAAAGATCAATCCAAATACCAATAAATCGTACCTCCC
TGTTTGAGATGTATCTTTGTGATCGTTGAATTCTCTCTACTCTCGTGGCG
CAAAAATAATGAAAAAAGAAAACTAAATGAGAAATCTCACGACGAAATAT
CGAAGCGGTTCAATCAATCGACGTACATATTTATCTCGTTCCAATGTGAA
AAATGGAGCACGAAGGACAGATTGTTTTATGGAAATATACGAAGAGGATA
ATGAGCAATAGATGAAAGAGAGAATGAGAGAGCGAGAGAGAGAGAGAGAG
AGAGAGAAATGGCCCAACGTGAGCGTGAATTTTCACGCATTCGCTCTTCG
TATCCACGCATAATTAATAATGACATAATTGTAGGTATCCTGTACGAGTA
TAGCAAACATTAGCGTAATTAAAAACAAATACAATTAATAATTATGAAAA
AAAAACAACAAACAAACAAAGTAAATAAATGTCATCTATCCTACCAAAAA
AAAAAAAAAAACATGACGTAAG
back to top