BAP2ALocus_1060_Transcript_2/5_Confidence_0.714_Length_3827 (mRNA) Venturia canescens

Overview
NameBAP2ALocus_1060_Transcript_2/5_Confidence_0.714_Length_3827
Unique NameBAP2ALocus_1060_Transcript_2/5_Confidence_0.714_Length_3827
TypemRNA
OrganismVenturia canescens (vcanescens)
Sequence length3827
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Venturia canescens transcriptome v1.02018-05-04
Sequences
The following sequences are available for this feature:

mRNA sequence

>BAP2ALocus_1060_Transcript_2/5_Confidence_0.714_Length_3827 ID=BAP2ALocus_1060_Transcript_2/5_Confidence_0.714_Length_3827|Name=BAP2ALocus_1060_Transcript_2/5_Confidence_0.714_Length_3827|organism=Venturia canescens|type=mRNA|length=3827bp
GGGCGCTTTTAGTACGTACGCTGGCCGTATATATGAATGATGCAGTTCAT
GCAGTACTATATGACCACTATGACTACGTACGTGTGTTTCTACGTTGTAA
CGATACACGAAAAAAAGTAGAATGTTCGTAGTAGCTTCGTGTGTAGCGGA
GAGAGAGAGAAAGTATTACGAATGAGAAATGGGCCACACGTGATTGGCTA
CGAATAAATATGCGTCGTAGAATGAAAATTTTCTACCTCACTGTTCGATT
CTATATTTTTATAGCTTTTATAATATAGGTATGTGGAATTTTTTATCAGC
AGTTTTCTACCTCACTGTTCGGCCGTCTTACGCCTTGCGTTGCGCCAGTC
GGAAACTTCACGCGTTCGCTACTGCACTCAACGCTATACTCTTATTCAAC
GACACAAAATAGTTTGTCAACACCACGTCAACATAGTCGTAGAAGCAAGA
AGCAACTATATTATTCTATTTTATAATAATATTACATCATATTGAGTTGC
CAATCAACATCACAACCGAGTTTTTATTATCAGTTTAATACAGAGCATCA
TGACGGCTCAATGTGGCATTGTTAAAATGCAACATCACGAGCAACAAGAA
CTATGCCAAACCAGAGCACCTTACAGACAGGGACGAAAACTAACTGCTGT
CAAGGTAGCGTGGACGGATTGTATACACAGTAAACGACGAATCTTCGCAT
ATAATAATAAATGGTGTGCCAAAGTTACAATTGTTGGGTGATGTCAGTAA
AATGGTAACTCCGTATGGTTCTGTAAAAAGAATCGAGTTGATTCTGGATT
ATCCAGTTGAGGAGTTCACTGAAGCGTTTCATATAAATTTTGAGCGTATT
CAAAGTGCAAGAATAGCTAAACGCTTCATAGATGGCAAGAATTTCTTTGG
TGGCTTGTTGCATGTATTTTATGCACCTGAACTGGAAACTGTAGCGGAAA
CACGGAAAAAGCTTGTGCAAAGACGAAGAGACATAGCAATTAGGATCAAA
AGGCATAAAGAGGATCCAACAAATTTAGACACTGATGAATTTGAACCCAG
AGAGCAATATCATCGGAAAAAAAAATATCCAACATTGCCATTAACCGAGA
AAAGGCTACTGCATCAATATCAGACTGAAACGCTGAGCACCATTTACAAG
GGCATTCCTCGCAGCATAGACCCTCGCCCTATAAGTGAACCTTCGCTTCC
AAAAAATTGGAATGAAACGAGAAAGGCAGAGTTGAATTTGAATGATCTTG
CAACTCCTTATGATGGAACAGATATTTTAGGACGTTCGATCCTTACTCAA
AAGAAAAAAAATTATCGCGGTCGTCCTATAAACAAAGAAGTCAAAGTATC
GGTGGTTCGGCCACAGATTATAGACACCACAAAACTTGCAGGTTTCATGG
AAAAAACAGATAAACAAATATTCCCAGTAGTTAAAAAAGTTGAAAGTGGA
ATAACGATTAAGGTTTTAAAACAAAAAATTGATGACGGAAAAAAAAGAAT
AGTAATGAAAGATCCAAGGTAATCAAAACAGTCTTTTATTTATCATATCA
AGTTAGATAAAACGGATGAAATTATTTTATAATCATGTATTTTTTCAGTG
CTTCCCTATTGGTTCAACCTAGCAACGACTTACAAGAATCTATTAAAACG
ATCAAATCAAATATACGGAAAGCTATGAAAAATAATTAAAATGGCCTAAC
ACGAATGAAAGGTCTTAATATAATAAGGCCACTTGTACAGTATAATTTTC
ATTTAATAAAATATAAATTATCGTAAGGCATGTTAACTTTTTTGCAGAAA
AAAGTCCAATAAATAACGTGGAGTTGTATAATTAGTCGATTATTAATTCA
TAAGTGAAAAAATACGCAGAAATAAACTCTTTTTCTATTATGCAGAGAAT
ATTTCGATCACTCCCATCGACATAAATCGCAAATTTATTTTAGTTGTAAC
AAATTTTTAATAAATTTGAACGTATTGAGATAAATTTAATATTTGGGTCC
ATCATTGATTTCCATCCGCGTGTTTATACGTTTCTTGTTGTTTACAAAAT
ATTTCCTAATTTATTCAATGTACATCTACAATCAAAGATATTAGGACTGA
AGAAATCTAAATATTCTTATCAATCCATGATTCTGATTATTGCTAAACGT
CAGAATGTTTCAGAGAAAATGTAACTTAAATTAAACTTATTGAGACGTGA
AAGAACTAATTAGTATTTCATTTCGTCGACGATTTCGAGGATCCCACTTA
ACTCGTAAGTTATAGCTTGAAACAATTATAATTAAAATTGAATGTGATGG
GATTTAAAGAACAGATTTTAGTTTTCGATTCGACCATTTATTAGATGATT
ACCGTGGAGTCCGGATCCCACTGAATTCCGTTAGGTTTCGTTTTCGAGAT
AAATCTTCCAGTGGGCGGAGTATTTTCTTGTTGAATCGATATCGTTGAAA
GACCTTTATTGCGTAATAATTGTTGAGGTGATTTTGCTGGTAACCTCGAT
CGTTCCTTGTGATTATTGGATCGATTGCCTAACGGTGTACGATTCAAGCT
TGTTTCGACATTGTGCTTAGCTTCGTTAAAAATTTTCCATTTCTTTTTTG
TTTGATTACTCGATTTGTCGTCATCAATTTTACTGGTAATCTTAACGACT
GTATTAACAGGTTTTGAATTTTTTGCTACGGTTTCGTCATCAAACTCAAT
AATAATTTCCTCGGTAGTTGTCTTGGTAACAACGTTTTTAGTCTCCTCAT
TGACATTAGGCGATATGGAATCTCTCCAAACTTTTATTTTGTCATTATTA
GCAGAAGCTTTTGGCTCATCAGTTGTATCTTGAATGACCGCCTTTATAAT
TTCGCTGATGCTGTGGTCCAACGTTTTGTACGAGGATTGGTCGAATTGTT
CGCCTTCATCGTTTAAATTATCCTCGGTTTCGAACGCTTCGTTTTCTGTC
CATGTGGAGGGAGGATTAGGATAGGCTGATAAAATTTTGGGATTACGTAT
TACCGTTATTTGTTCTTCATTCTCGCTACAATCTGACATTTCCTCTGAAC
TGCCACGTTTTGAAAACGAATCTTTAAGAACCTCGCCTACTTCGAAACGA
TTTTCCAAACTCAGTGATTCGTCACATACCAAAACTGTCTCAGAAATCGT
TTGTATTTCTGGAATATTGTTAGCCGTTGTTGTTTCGCAATACGACAAAG
TATTATTTCCATTTTTAATTTCGGTTAAAGTTAGCATCGAATCTGTCAAG
GTATTTGTTTCTGCATACTCCGTTGATCTTGTTTTGAGAATTGGAGTTCT
ATCAAAGTCCATGGCTGGCGATCTTGGATCGAATGTTGACAGAATTGTTC
GAACACCTACCGGTGTTTCCATTTCAGGAGCTTCATGAACCTTCACCACA
GGAGATACGTAATTATCTGTTGATTTTACCACGATTGGAGTACGCTGTTG
ATCAACGTTTGGTGAACGAGGATCAGCTATGGATTTTTCTGGTGTTGTGA
CAGGCATGACAGTGTCAAAATCTGTTTCCAAGTAACATTTTCCCTGCAAA
TATTTTGGCAAGGCACTGGCTACTCGTTGATTTCGACCTGGAGGCGTTTG
TGAAGTCACCTCAATAGGAGTCCTGATAATGCCCATGGTCGCGGATCTCG
GGTCACTGGCAAATTTTCGTTTAGTAACAGGAGGAGTCCACATTCGAATG
TTGCGAATGCTACTGGGGCTTGTTTGGTTAGATTTGGTTATTCGGTCATG
TTCATTATGTGAAAACAGCTTACTCGTGTAGTTACCCATGCTAGGAAAAA
TATCGCTTATGCGATTTATTCAAAAAA
back to top