BAP2ALocus_1067_Transcript_2/3_Confidence_0.222_Length_416 (mRNA) Venturia canescens

Overview
NameBAP2ALocus_1067_Transcript_2/3_Confidence_0.222_Length_416
Unique NameBAP2ALocus_1067_Transcript_2/3_Confidence_0.222_Length_416
TypemRNA
OrganismVenturia canescens (vcanescens)
Sequence length416
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Venturia canescens transcriptome v1.02018-05-04
Sequences
The following sequences are available for this feature:

mRNA sequence

>BAP2ALocus_1067_Transcript_2/3_Confidence_0.222_Length_416 ID=BAP2ALocus_1067_Transcript_2/3_Confidence_0.222_Length_416|Name=BAP2ALocus_1067_Transcript_2/3_Confidence_0.222_Length_416|organism=Venturia canescens|type=mRNA|length=416bp
CTTTTTTTTCGAGTAATTGGCTATAAATCGTGAATCGCAATAGAAACAAT
TCTGCAGCATGTTCTAAAATGTTTTATATGTGAAATTGAAACTTTTAAAG
TTTACCTGCTTGGCATCCTTCACGAGGTCCTCGAATTTTGCGTCATCGTT
CAATAGTTCTTTGAGTTCATCATTGTTGAGATGATTTAACAAACCCAACG
CGGCTGGAATGTCCGGTTCTTGGTTGGGGTTAAACATTGTAATTATATCA
ATAATATTCCGCGACTTTTCAACATGTACACGATTATTTCCCCTTTGTTT
CTTCCTTCGCCAATAAAAATGTACGGCCCTTGTTTTGCAGAACAGAGTAA
ACGATTATTACGTGGAATGTTGAAAAGTCGCGGAATATTATTGATATAAT
TACAATGTTTAACCCC
back to top