BAP2ALocus_1067_Transcript_3/3_Confidence_0.778_Length_2982 (mRNA) Venturia canescens

Overview
NameBAP2ALocus_1067_Transcript_3/3_Confidence_0.778_Length_2982
Unique NameBAP2ALocus_1067_Transcript_3/3_Confidence_0.778_Length_2982
TypemRNA
OrganismVenturia canescens (vcanescens)
Sequence length2982
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Venturia canescens transcriptome v1.02018-05-04
Sequences
The following sequences are available for this feature:

mRNA sequence

>BAP2ALocus_1067_Transcript_3/3_Confidence_0.778_Length_2982 ID=BAP2ALocus_1067_Transcript_3/3_Confidence_0.778_Length_2982|Name=BAP2ALocus_1067_Transcript_3/3_Confidence_0.778_Length_2982|organism=Venturia canescens|type=mRNA|length=2982bp
GTTATTCACTGTTTTATAAAGTAAAAAATTAAAACAAAATGGAAAAGTAA
TAACAAAATCTCGTTTGTACGAATATTTGAGCATTATTCTAAAAATCGTG
GTACCAGTCTATCAGCTGATCGATTACAAGTGCTTAATCTTCACGTGGTG
CCTTTTGTGTCATATTGCACATCCTTCATAAGTATTCATAACCAAGCAAC
AATGTATTGGCGTCACGAAACCCTTGGAGGTATATAAAACATGACCTTGA
ATGTTGAAAACTGTCTACTTACGAGAATAACTTACGGAGTATTTATTTTA
AGGTGACCTTTAAGATGAACGTAATGATGAGTGAAAAAAATGACCTTTAA
GATGAACGTAATGATGAGTGAAAAAAATTGTAATATTCAAGAGATCCGAG
GTATAGAATCCGAGTTCTGAAGGACAATGAACAAGTCATCAAGTTCAAGA
TTTTTATTGAGCACTATGATGTTGACAAGCAGGATGCGGATGTCAACAAA
ACCAAAAACACCTTCGCACTACGATACTCTCGAGATTAATTATCGAGCAA
CACAGGGTGAGATTAAATCAGCGTATTTCAACTTGTCCAAACAGTATCAT
CCTGATAAAAATGACAGTGAAGAAGCATCTCAAAAATTTCGGGACATTAG
CAACGCTTATGAAGTCCTGAGCAATTTCAAGAGTCGTAAAGTGTATGATC
GAAGTTTGATCATTAAACCAAAACATCAAAAACAACATGGACAAAGTACC
ACGGTGGATCCAAAGATACAATACTATCAGACACAAGCAGCCATTTTTAA
ACAAGATGCTAAAACTGGCAGCACTCCTATGTACGATTTTGATGAATGGA
CCAGGGCTCATTATGGGAGAACTTTGAAAAGGAATATACAAGATAAAGAA
GAAGCTGAACGGTTACGAGAGTTGAGACAACATTTTGAGAGCTCAACCTC
TCATAATATATCAGAAGATCGATCTATGTTTCTAATATCCATATTACTTT
TTGGCACTGTAGTCTTTCTCGGCATGTACAATCATTCTGATGACTTACAT
TTAGCTCTGCAGGAGAAAGAAAAATTTGAAAAAAAAAAAATTCCTGAAAA
CTCAAAAGCCACGACAAACTCTATTTCGTCAGATTAGTTTAAAGAGTTAA
AGGTCAACTATTTGATTTTTGGATCAGTGTTGATTAATGCACCTCTTTAA
ATATTGTTTCCTCACTAAATTAGTTTTTCGACTGGTTTAAAAATATGTAA
AAAAGTTTATCAAAATTCCCATCAATTATAGATTATTCAGTGCGAAACAA
CATCATGATGAGCAGCAACGAGTACTATTCCAACAAGTAATACTACAATG
TTGTACAAACACGACTCCACTGATGTTGCAAAAAATTTTTGATGGTTAGT
CAATGTGTAAAAAAACAAAATGTAATGTTTAAAAAGTTGTAAATATTTGT
GTGATAGAATAAAATTACAAAAATATATATTTTCAATACAGATTTATATT
TTTTCATTATAGCAAATATCAAATAATGAGATTGGAAAAACAAGAATGTG
ATAAACGTTGTAATGCAATATCGTTTTTTGTTGTGCTGATTATTTATTTG
AACTAAGTGAAACAGTAGGTGGTTTCCAAAACGAATACGTGTAGAAATTT
TATTACATAGAGAAATATAAATTCATTTATTACACAACATGATACTTTAA
ATAGGGTGCTCAATAAATTGAACGCATTTGTTTTATCTTACATTATACAT
TATATCAGATGATCATGAATTTCGCTTTTGTTTTTCTTTTTTTCTTTCGT
CGTGTTGCTAATAAAGATAATACATTCTCACTAATGTTAGTCTTTTTTTT
AATATGGGCCACTTTATGAAATTACTTATTTTTTCGTTACAAGTTATTCT
TCTGTCGTTCTCTATAATTACAAGATCTGCGCACGCTGCGCATCTGTATG
TGCGTAACTCCACCTCACGTTATGTTGATCTTATTTATTCCCAGGCTTTT
AATAAGGTCTGTATCCAGGCATCGGCATGGATAGTTGATTTGTTGGATAT
GGCAATCCTGATCCCATGCCTGGATAATTACTAGCCAGAGGATAACCCGG
ACCTATTGCTGACGGATAACCCACAGATTTTCTTCTTAATTCCCGCATCT
TGTCAACCTTAACTTTGCGATGATGCATTAATTTTCTCATCGTCATAAAT
TGGTCCAGGAATTCTTCCACTTCAACATCACCGGCAATAAATTTTTCTGC
TAGTTTCTTAAAAAACAAAGATTTCGATATGGAAATTTTGAAAAAAAAAA
ATCAGTTCCTCCATCACACCTATAACTTCTTTTTTGGTTCTGTTTGTATT
AGTTGAAACAACTCACTTCTGATTCCTCCTCAATTTCCGCTGCTCCCGCT
TGCAAAAGCTCAAGTGTTCTGATTCCTCCTCAATTTCCGCTGCTCCCGCT
TGCAAAAGCTCAAGTGCATGATCAACGGACATAGAACCTGATTTTTCCTT
TAATTCCTCCAGTTTCTTCTGAACACTAATACAAAGTTCGCTGCCCTGTT
CCCCTAATTCTTTCAGCTCTTTTTTTCCTTCTTCCAGTTCTGGTTGTTTT
GCTAAATTGAATTCTGCAAGTGATCTGTTGCTCGCCATGAGCATTTCCTT
CTCTGTTTCCAAATCCTTGAACTGCTTGGCATCCTTCACGAGGTCCTCGA
ATTTTGCGTCATCGTTCAATAGTTCTTTGAGTTCATCATTGTTGAGATGA
TTTAACAAACCCAACGCGGCTGGAATGTCCGGTTCTTGGTTGGGGTTAAA
CATTGTAATTATATCAATAATATTCCGCGACTTTTCAACATGTACACGAT
TATTTCCCCTTTGTTTCTTCCTTCGCCAATAAAAATGTACGGCCCTTGTT
TTGCAGAACAGAGTAAACGATTATTACGTGGAATGTTGAAAAGTCGCGGA
ATATTATTGATATAATTACAATGTTTAACCCC
back to top