BAP2ALocus_1068_Transcript_3/6_Confidence_0.125_Length_2206 (mRNA) Venturia canescens

Overview
NameBAP2ALocus_1068_Transcript_3/6_Confidence_0.125_Length_2206
Unique NameBAP2ALocus_1068_Transcript_3/6_Confidence_0.125_Length_2206
TypemRNA
OrganismVenturia canescens (vcanescens)
Sequence length2206
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Venturia canescens transcriptome v1.02018-05-04
Sequences
The following sequences are available for this feature:

mRNA sequence

>BAP2ALocus_1068_Transcript_3/6_Confidence_0.125_Length_2206 ID=BAP2ALocus_1068_Transcript_3/6_Confidence_0.125_Length_2206|Name=BAP2ALocus_1068_Transcript_3/6_Confidence_0.125_Length_2206|organism=Venturia canescens|type=mRNA|length=2206bp
AACATCATTTATTAAGGGATAAAATAAATGACAAATAACATATCGCTTAT
ACGAAACTATAACATTTCTTAAAGTGTTCATTATTTGTTACGATATAAAA
GAAATCACATCACATACGATCCTCCTATCATTTGCATATTCTTTGTTTTT
CATATTTTTCTCCGTAACGATCATTGGCCCTTGGATTGCGTATTGAGAAT
GCTCATATATTTAATCGATCGAGCACAAGTATTTTATATTCTCTGCATTG
ATCAATCGATTTTTCGTCCGAAAAGAAAATTCCATAAAGATTGACGAAAG
AGTTAGGCATTGACCGCTCAGCTTAACTCGATCGTTAAGAGCTTCATGGA
AAAGATGGTTTCCTCATTCCCGTAACGAAAGAAAGTATAATTGTTCTTTG
TTTTTTTTTTTTTTTTTCGAACAGTGGATGAAACAGATGTTTTAAGGTAC
AATGATCGTTGACGATTTTCTTTTTCCTGGCCACTCTCACAGGCCTTCTC
TATCAGTTTTTTCTCATACTTATTTTCTCACTTGTCATTAAAAAAATCAG
TATTCATATATAATATATATATTTGTTTTTCTCGGATCCATGACACAGAG
CAAATTCAGCTCGTAAGAATTATCACACTATACATTGTGGTAGCATGGTA
TACAATTAATATGGTTGATGGTTTCGAAAGATGGGTTTGTTGTTGGAATC
GCAAAAGAAAATATTACTTCGTACGGTTCGATTTTTCGTTACACATATAT
TCACAGATTTCTATCATTGTGTTTTGCTCGTCAAGCGCATCTTGCTGAAA
AGTTTGTTGACTATAAATACGAAACGCTTGTTAAACAGGCGTATGAAAAT
TTAAACGTGTTTTTGCTGACGATCTAGTTTTTTGCAGCAATAGCAGTCTG
ATAAAAGAGAAGAAGATGGATGAAACATTTCGACGAAAATGAGGCTCTTA
CAACAAGAAAAATAAAGATTGAAATTTCGGAAAAAAGCTCCAAAATCAAG
GGCCACTATGATTTAATGCTGACGAATGATCATTTTGTTCTTTTTTCTCT
TCTCTTAATTTCGTCCTCACAGAAGTAACGATTTTTTCTTCGATAATTAT
AATTTTTTTCTCATATTTCTTTCAATCGTTTATAACGGCTTCTTTTCCTG
ACAAGCCTGTCTTTGTTGCTAAATAAATTACAAGAGTGAAAATAATAACT
ATACTCTGCCATCTTTCAAATTTTCATTTTTTCCACCAACAAAACATTTT
CTGTCGACACACATTTTCTTTCTCTTTTTTTTTCTTCTCCAGAATATTTA
TCTGTTTCATTCTCAATATATGAAATCACACAGGCTTACGTACACTCACT
TTCCCATACACACACACACACACACGCACACTTCGGAGGATCTCTCGCGT
AACGTCACTTCGCGTTTCTCATCTCCATGTTACACGCATAAAAATCACCG
ACCAACGAGTCCTGAATCTCGCTTCACAAAAAAAGCATCTACCTGCCTCG
AATACAAAAAAAACAAACGAAAAACGAAATCTACAATTATATAAGAGAAC
AGTGTCTTGATTTGTTTTTAAGTCTAAATTTTTTTTCATCTCTCAGTCCC
TCGAAGAGATCATTCAGCGAGAAAATTGCAAGCGCACTCGCGATTCTTTT
TGATTCAACATTTTTTTTCCCCTTTGAGGGTTTTTTTCTATGCATTAATT
CACTTTCTTCTCGAGAAGCGTCGAGGTGCGTTCGCAAAAATTCGCATTCT
GTGTATGCACGTTTGTTTTGAATGAATAATGATATTTAAAAAAAAAAAAA
AAACGAAAAAAAAAACAATGAAAATAAACAGCCCTGTGAAATCTCCACAG
GGTTTTGGCATATTACAAATAAGGGACCGATTAAAAAAAAAAGGTAATTG
GTTTCAATAAAAGTTAACTATAGATAAAAACACGATACATAGAAAAATAA
AGAGAATAAGAGAAAAACGTTGATCGATATTCGTAAAGATTTTCTTTACC
GACGTTTAAAAAAAGAAGAAACAAAATTTTCTCATTTTCTCCTTTAAAAA
GTTTTCTCACAAGGTCTCTTTCTCATTCTCAATTTTTTTCTTCAACGCTA
ATAATCGATTTGTCGTTCCAACTGATTCACGTCACTTCTCTCTCTCTCGC
TCTCCCTCTCGGTCTTTCGATCATCCATTTTCCTTTTGATAATGTTTATT
TATGAC
back to top