BAP2ALocus_1069_Transcript_2/4_Confidence_0.500_Length_4002 (mRNA) Venturia canescens

Overview
NameBAP2ALocus_1069_Transcript_2/4_Confidence_0.500_Length_4002
Unique NameBAP2ALocus_1069_Transcript_2/4_Confidence_0.500_Length_4002
TypemRNA
OrganismVenturia canescens (vcanescens)
Sequence length4002
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Venturia canescens transcriptome v1.02018-05-04
Sequences
The following sequences are available for this feature:

mRNA sequence

>BAP2ALocus_1069_Transcript_2/4_Confidence_0.500_Length_4002 ID=BAP2ALocus_1069_Transcript_2/4_Confidence_0.500_Length_4002|Name=BAP2ALocus_1069_Transcript_2/4_Confidence_0.500_Length_4002|organism=Venturia canescens|type=mRNA|length=4002bp
TGGTGGACGCGTCTTTCTCATCTTCGAACAAATTTTTCGACGAATCTTCT
AACTTCACATTTGAAGAAAGAAGATTCGTCGAAAAATTTGTTCGAAGATG
AGAAAGACGCGTCCACCACCGACGGTGCAAAAATTTCGAAAGCTTCTAAT
CTCCCCGATGTTATCGGTGACAATACGAAAAGACATCCACCGAAAACTTT
GAGCATACGATTACCAGTTGCCAGCGAGGACTCGTCGCAGCCTCCACCAC
GTCGCGTCGTTTCCGACAAGATTAAACACCTTAAAGGGAAAATGGGCGAT
TTCAAAGTCCTATCACCCACCGATACGCCACCAGTGTGGCGAAAATCTAA
GGAAAAAACTGAATCCGAGTCCGAGAAAACCGAAAGTAAAGACAGCGAGG
ATGGCGGCCTCATGAGCGTTCCAAGCGCAACATCCCCTACGAATACTTCG
AACAAGGGTATCGATGACTCAGTCGAAACTGCAAACGAAATAGCTCCAAG
TTCACCACCAGATGACTCTGGAAATTCGGAATCTGCTGTCAGTTTTGATG
TTCCTGCTCAGGTCGAAGTTTTGGCTGTGACTGCCTCCAAGAGTCGAGCG
AGAATACAAGCGAAAAGACGACCTCAAAGTAGGCACGCGAGACAATCAGC
TTTGCGGAAGAGTGGAATCGATTTCGACACAGTCGATAATACGGGAAGCG
AAGCAGTGGAATCAGATCCAAGCGACAACACGTTTTCGGGTATTTCGGAG
AAAATACCGACGCTAATTACAGACTCGATTGGTCCGGATTTAACGAGGTC
AGATCGTCTTGCGGAGAAAGAATCGGAAGCTGGAAAATTGTCGAGTGAAA
AAGCGATCGTGGAGACGAGTTCTTCGTTAGCTCCGGAGGACAGATCAGAA
ATGAGTTTCAGCAAGGGTAGTTCATTGAGCTTGAACAAAAACACACTGTT
GTCTCCGTCAACGGACGAGGAAGATCTTTTCGACGTGCCACCCGATTTGC
CCGAGGATCCGCCGAAAGAAGACACGCTGTTTGGCAGAGCGCCGATTCTT
TCACCGATCGATCGTTCCCTCGGCCGGAAAATCACACGAGTCAAGGAGAA
GTCAAGAGAAAAATATTCAAATATCGAAAGCGAGGAAGCGGCCAGAATTC
AGGAAAAAATGAAGAGCTCGGAGGATAAATCGAAAACGGAAACGATCTCG
GAGAGCGAGTCAGCAACGGAAAAACCAACGGATCCTCTTCGCGACAACAA
TCACGATCCCTTGAAAGATCCCAGTCAACTGTTCGCTTTCGTGACGAAAA
CTCCGTCTCCGGAAAAGGGCCAAAACCTATTGTTCAAAGAGGACGCGAGT
TTATTCACGCAGTTAGCGAAGAAAGCGGCAGAAGAAGCGAGATTGAAGAA
GCCCGTTTTGGATTTATTCGCCGATGACAACAGCGGCGATTTATTTTCCG
AAACGCTCGCCAAGTCGACGAAAAAACCCATGAGAGCAATTAAAAGTGAC
AGTCTTTTCGACGACCTGGAAAATCCCGAAGAGGATTTTACGGTCGATCT
ATTCGGCAGTCGTTCGAAAAACAGCCAGGAAAAAACCGAGAAAATGGAGG
ATTCGGTGACGTCAAAGAGCAGCGAAACTTCGGGACGCGCCTCGCCCAAT
CGTGGCTCCATCTTCGCTGCTGCGGACGATGACGATCTCTTCGTTAATTT
GCCTGTGAAAAAAGTGTCCTCGGAACCGGAAAAGCAGCCGGAGTCCAAAG
AGAAAATCACCAAAGACCCGTCTTCGAAGAGCAGAGACATCTTTGGAGAC
CAATCGAGTGGCGAGGAAGATTTATTCACAAAGAGCAAAATCATTGGTTC
CGGAAAAAGCGTGGGTGCAAGCGGCTCGATATTTTCAGCTGCTCCTAACG
ACGAGGACGCCGATGACATATTTGGCACGAGAACATCTTCCAAAAGTACG
AAAATCGAGCCCAACGAAAATCGTTCGAGTGTCAAGAAAGCTGTTACGAG
AGATTTGAAAAAAACTGCCGAAACTATTGTTCAAGATCCTTTGAGCATGC
TCCAAGACGACTGATCCAATCGTGCATACTCGAATGAAGGAAAAATCCAC
TCATACACATTATACGTGTACCATACAACATATATTTTTCTATTTACATT
TATTTACAGTTTCAAATATTACCGTTATATATTTCACGATCGTTCGATCG
AAGAGACTCTAATGCTCGCAGAGAAGATATACGTACACATTAATTGTCCC
TTAAAGCAAAATTGGGGTCTGGATTACGCCAAGCAGAGCTTCGAACCAAA
ATTCATCGCGTTTCCAACTTGAAAATTATACATTTGTCCGAATCTACCTA
TTCACCGCCCATGTACATTCGATTAAGCTCTAGAAAATCGTACAGAAGTA
TATTTTAAGGGTAATTTAAAAATCCTAATATCTATACATCCCTTGACGTG
TACTTGGGTCTTGGAATCGTTGGGGCAAGGTTCGAAACCGAGTTTCAACT
TTCAAAAGTAAACAATCGTTCTCTTCATAATCTCATTTTTCTCTGGGCTC
CCCCGAACCCATGTAACTTTTTGCTCCTACAAAAAATCATTGTTTTAAGG
GGTATTTATACATGAATATTAATGTATATATAGAGATAAGAGGGCACGGA
GCCGAGTTGAAATTCTACGTAACTACGATCATTTTTAATGTATCTGAACC
TACATAAGTTTTGGGCTAAAATATTTCCAATTAATCTTTTGTGACGTTCC
GGAGATTCTTGAGGGTCCTTTGCCGATTTTTTTTTTGTGTTTGATTTTTT
TTTTTTAATCACGACTGTACAAAAGATTTCCAACACGTTCAGAAGTTGTT
AAAATTTAGCTCCAAGTCTTGTCGTTTGTGAGCAACGCTGAAATCGAATC
GCGATTCCATTGAGAAATATTTTTACTGAAATCTTATGTTGAGTTCAGCC
CCATGAAAGTGGTTATAAAATCTCATTTCGTAAATCATTGTTTTTTCAAT
TTTGTTATTCTATTCGATCGATCTGCGGCGTAATATTATTTCACTCGTTT
GAAATCTGTATAACAGACTGTATCAATATTTAAGAATAATCCGAGATCTA
CGAAAATACTGTTCGCTCGATCAAGCAAATTTATCTTGTTTTTGTTTGTT
TTTTTTTTTTTAATTTTTATTTTATTCGAATAAATATATTGCGCATCCAA
AGAGAGCATAAATTTGTCTCGGAGTAAAGATACTCGAGAGAAATGTTACG
CTCTGGCTTCGTGTAGAATAAAATTAAAAGGACAAGAAAAAAAACAATCA
CGACGAATAATGACGAACTTTGTCAGCATTTGCAAATCAAATGTCTGTCG
TTGCATACTCTTTTATATACGATCTAACAAAACAGGTGAAACTTTCCATG
TTTAATTGTCCACCTTGTGCTCTAATAATTTTGTCACCGCTGAAAAGAAC
CTTGCGATTATTCGTGGATTTACGACTTTTAGTATCAGTCGTTGAAGAAC
CTGATTAAAGAATATTTAAAAATCACGATGCGAGAGAGAAAACTGCAAAT
TTAAAAAGTGCCATTTTTTCAGAGATTCAAAAATTTCAAATCTTTTTTGT
CATTGTTCTGCTTGGACTGGAACTTTTTTTTTGTAAATGTCAACGGCGAA
AATACTCTGAAGCAAAGCTCAAGGCACTCGAAGCTCCTTAATTTAGGGCC
AACGAGGATTGTTTGACTGGAAAAGTCATTTCGAATTAAATCATATTCAC
TGTAGCATTGGTTCAACCATTCTACTAACAATCAATTCCAACAATGTTAT
TCATCTGGAAACTATTTTTTTCAACGAACTTACACTTTTGAGCTGTTGAC
ACCGTCGATACCTGTTGAGAAGGTGATGTGCACGATCGTTGCAAATTTGA
AGAACTTTAAAAATATCGCATATGTAATGTTAGTTATTATATCTCATAGC
AATGTACAAAGTTCTAAAGTAATGAATGAAGCGCCTAATACAAAGTTCGG
AG
back to top