BAP2ALocus_1069_Transcript_4/4_Confidence_0.600_Length_5341 (mRNA) Venturia canescens

Overview
NameBAP2ALocus_1069_Transcript_4/4_Confidence_0.600_Length_5341
Unique NameBAP2ALocus_1069_Transcript_4/4_Confidence_0.600_Length_5341
TypemRNA
OrganismVenturia canescens (vcanescens)
Sequence length5341
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Venturia canescens transcriptome v1.02018-05-04
Sequences
The following sequences are available for this feature:

mRNA sequence

>BAP2ALocus_1069_Transcript_4/4_Confidence_0.600_Length_5341 ID=BAP2ALocus_1069_Transcript_4/4_Confidence_0.600_Length_5341|Name=BAP2ALocus_1069_Transcript_4/4_Confidence_0.600_Length_5341|organism=Venturia canescens|type=mRNA|length=5341bp
ATACTCTTTTCGAATTTCAATCCTTTTCTATGCTCATTCTTTCATCGACT
CACGTTACCATTTTTGTTTTCATTATGATGCCAATCAAATGACTTCTATA
CCGAGAAGATAACACAAATTCAATATTCTTATGAGCCAATGTTATTAGTA
CCAGTGCTGTGAATTTTGGGAAACATCAACAAATTTTCTAAGCGCTGACT
TCCAGCCGGAATGGGAATCGACTCGTTTGAAGTCCGAGGAGATATATCGA
GAGAGATTCGCTAGTGACAGTTTGTTCGAAGGCAGAGGAGCTAACGCCGA
GAGTACAAATTCGACAGATTCAAATCAGAGGCAGCACAACGTGGCTCGAT
TTATTGCGGAAACACTGGACACCGGTAGAGAGGAAGATTTTGACGTAGAT
GACGTTTTCGGACCACCGCCACTGCCCAAACACAACGATTCCAAATCCAA
GTCGAACGACGATCTATTTTCGAACAGCAGTTCCGAATCTCGTTCGCACA
AGAGCTTCGACCTACTGGCGACTGGTGAGTCGCAGTACGACGTGAAAATC
ACGTCTGACCGGGGCGGCGGATTGTTCGACGAGGACATTGATATATTCGG
TAGCGGAGACGCTCCGCAAATCGATATATTCGGTGAAGCATTCAAACCCA
CGAGTTTCGTATCTCGAGAATCGAGTGAGCAGCCCGTTGCTAAAATTCAA
TCTGAACCGAAGGGAAACAGTTCGTCGAGCAACAAGTTAGATTCTTCAAC
AGAAAAAGTCCCGGGTAATGTAAAAGCTTCTTCGACTGCGAGAGCTTTGG
AAGAGTCCGTTGTCAAAAGTAGCAGCATATTCGACGACAGCGAAGACGAC
AACGACGACGATTTGTTTGGCCACAGTTTTCTCAAGAGCAATCGTACGCC
TCGAAAAATCATGTTGGAAAGTGAGGACGATGAGATTTTCACGAATAAAC
CAACCACCACCACCACAACGGCGGTTAACGAGACGAAAAAAGAACCCGCG
AGCTCGTTGGCTCGCGAGAACGTTGCCAATACAACTAGCACCGAGCGCGA
TCTCCCAAAACACGACAGTGATAAACCAGCCACTGAAAAACCGTTGCCAA
GTTTTTCAAGCTCCGGTCTCTTCGACAATCTCGAAGAGAAAGACGCGGAC
GATAGTTTATTCGTTCGTGACGTATCGAATGATGAGGCAACGAGTGAAAA
AACCGAAGATAAGCTGTTCGACGACGTTGCCACGAGCGAGAAATCGAAAA
AAGAGGAATCGGGTTTTAAAAGTAATCGCGCTAAATTCGAGGACATTTTC
AAGGGTCCAAGTGTCGATGAATCTGGCATGAAAAAGCCTGCAACGAAAGA
AGCCGATTCCGATAATTCGCCGAGAAACACGACACCGGAAACTTCACATT
TGAAGAAAGAAGATTCGTCGAAAAATTTGTTCGAAGATGAGAAAGACGCG
TCCACCACCGACGGTGCAAAAATTTCGAAAGCTTCTAATCTCCCCGATGT
TATCGGTGACAATACGAAAAGACATCCACCGAAAACTTTGAGCATACGAT
TACCAGTTGCCAGCGAGGACTCGTCGCAGCCTCCACCACGTCGCGTCGTT
TCCGACAAGATTAAACACCTTAAAGGGAAAATGGGCGATTTCAAAGTCCT
ATCACCCACCGATACGCCACCAGTGTGGCGAAAATCTAAGGAAAAAACTG
AATCCGAGTCCGAGAAAACCGAAAGTAAAGACAGCGAGGATGGCGGCCTC
ATGAGCGTTCCAAGCGCAACATCCCCTACGAATACTTCGAACAAGGGTAT
CGATGACTCAGTCGAAACTGCAAACGAAATAGCTCCAAGTTCACCACCAG
ATGACTCTGGAAATTCGGAATCTGCTGTCAGTTTTGATGTTCCTGCTCAG
GTCGAAGTTTTGGCTGTGACTGCCTCCAAGAGTCGAGCGAGAATACAAGC
GAAAAGACGACCTCAAAGTAGGCACGCGAGACAATCAGCTTTGCGGAAGA
GTGGAATCGATTTCGACACAGTCGATAATACGGGAAGCGAAGCAGTGGAA
TCAGATCCAAGCGACAACACGTTTTCGGGTATTTCGGAGAAAATACCGAC
GCTAATTACAGACTCGATTGGTCCGGATTTAACGAGGTCAGATCGTCTTG
CGGAGAAAGAATCGGAAGCTGGAAAATTGTCGAGTGAAAAAGCGATCGTG
GAGACGAGTTCTTCGTTAGCTCCGGAGGACAGATCAGAAATGAGTTTCAG
CAAGGGTAGTTCATTGAGCTTGAACAAAAACACACTGTTGTCTCCGTCAA
CGGACGAGGAAGATCTTTTCGACGTGCCACCCGATTTGCCCGAGGATCCG
CCGAAAGAAGACACGCTGTTTGGCAGAGCGCCGATTCTTTCACCGATCGA
TCGTTCCCTCGGCCGGAAAATCACACGAGTCAAGGAGAAGTCAAGAGAAA
AATATTCAAATATCGAAAGCGAGGAAGCGGCCAGAATTCAGGAAAAAATG
AAGAGCTCGGAGGATAAATCGAAAACGGAAACGATCTCGGAGAGCGAGTC
AGCAACGGAAAAACCAACGGATCCTCTTCGCGACAACAATCACGATCCCT
TGAAAGATCCCAGTCAACTGTTCGCTTTCGTGACGAAAACTCCGTCTCCG
GAAAAGGGCCAAAACCTATTGTTCAAAGAGGACGCGAGTTTATTCACGCA
GTTAGCGAAGAAAGCGGCAGAAGAAGCGAGATTGAAGAAGCCCGTTTTGG
ATTTATTCGCCGATGACAACAGCGGCGATTTATTTTCCGAAACGCTCGCC
AAGTCGACGAAAAAACCCATGAGAGCAATTAAAAGTGACAGTCTTTTCGA
CGACCTGGAAAATCCCGAAGAGGATTTTACGGTCGATCTATTCGGCAGTC
GTTCGAAAAACAGCCAGGAAAAAACCGAGAAAATGGAGGATTCGGTGACG
TCAAAGAGCAGCGAAACTTCGGGACGCGCCTCGCCCAATCGTGGCTCCAT
CTTCGCTGCTGCGGACGATGACGATCTCTTCGTTAATTTGCCTGTGAAAA
AAGTGTCCTCGGAACCGGAAAAGCAGCCGGAGTCCAAAGAGAAAATCACC
AAAGACCCGTCTTCGAAGAGCAGAGACATCTTTGGAGACCAATCGAGTGG
CGAGGAAGATTTATTCACAAAGAGCAAAATCATTGGTTCCGGAAAAAGCG
TGGGTGCAAGCGGCTCGATATTTTCAGCTGCTCCTAACGACGAGGACGCC
GATGACATATTTGGCACGAGAACATCTTCCAAAAGTACGAAAATCGAGCC
CAACGAAAATCGTTCGAGTGTCAAGAAAGCTGTTACGAGAGATTTGAAAA
AAACTGCCGAAACTATTGTTCAAGATCCTTTGAGCATGCTCCAAGACGAC
TGATCCAATCGTGCATACTCGAATGAAGGAAAAATCCACTCATACACATT
ATACGTGTACCATACAACATATATTTTTCTATTTACATTTATTTACAGTT
TCAAATATTACCGTTATATATTTCACGATCGTTCGATCGAAGAGACTCTA
ATGCTCGCAGAGAAGATATACGTACACATTAATTGTCCCTTAAAGCAAAA
TTGGGGTCTGGATTACGCCAAGCAGAGCTTCGAACCAAAATTCATCGCGT
TTCCAACTTGAAAATTATACATTTGTCCGAATCTACCTATTCACCGCCCA
TGTACATTCGATTAAGCTCTAGAAAATCGTACAGAAGTATATTTTAAGGG
TAATTTAAAAATCCTAATATCTATACATCCCTTGACGTGTACTTGGGTCT
TGGAATCGTTGGGGCAAGGTTCGAAACCGAGTTTCAACTTTCAAAAGTAA
ACAATCGTTCTCTTCATAATCTCATTTTTCTCTGGGCTCCCCCGAACCCA
TGTAACTTTTTGCTCCTACAAAAAATCATTGTTTTAAGGGGTATTTATAC
ATGAATATTAATGTATATATAGAGATAAGAGGGCACGGAGCCGAGTTGAA
ATTCTACGTAACTACGATCATTTTTAATGTATCTGAACCTACATAAGTTT
TGGGCTAAAATATTTCCAATTAATCTTTTGTGACGTTCCGGAGATTCTTG
AGGGTCCTTTGCCGATTTTTTTTTTGTGTTTGATTTTTTTTTTTTAATCA
CGACTGTACAAAAGATTTCCAACACGTTCAGAAGTTGTTAAAATTTAGCT
CCAAGTCTTGTCGTTTGTGAGCAACGCTGAAATCGAATCGCGATTCCATT
GAGAAATATTTTTACTGAAATCTTATGTTGAGTTCAGCCCCATGAAAGTG
GTTATAAAATCTCATTTCGTAAATCATTGTTTTTTCAATTTTGTTATTCT
ATTCGATCGATCTGCGGCGTAATATTATTTCACTCGTTTGAAATCTGTAT
AACAGACTGTATCAATATTTAAGAATAATCCGAGATCTACGAAAATACTG
TTCGCTCGATCAAGCAAATTTATCTTGTTTTTGTTTGTTTTTTTTTTTTT
AATTTTTATTTTATTCGAATAAATATATTGCGCATCCAAAGAGAGCATAA
ATTTGTCTCGGAGTAAAGATACTCGAGAGAAATGTTACGCTCTGGCTTCG
TGTAGAATAAAATTAAAAGGACAAGAAAAAAAACAATCACGACGAATAAT
GACGAACTTTGTCAGCATTTGCAAATCAAATGTCTGTCGTTGCATACTCT
TTTATATACGATCTAACAAAACAGGTGAAACTTTCCATGTTTAATTGTCC
ACCTTGTGCTCTAATAATTTTGTCACCGCTGAAAAGAACCTTGCGATTAT
TCGTGGATTTACGACTTTTAGTATCAGTCGTTGAAGAACCTGATTAAAGA
ATATTTAAAAATCACGATGCGAGAGAGAAAACTGCAAATTTAAAAAGTGC
CATTTTTTCAGAGATTCAAAAATTTCAAATCTTTTTTGTCATTGTTCTGC
TTGGACTGGAACTTTTTTTTTGTAAATGTCAACGGCGAAAATACTCTGAA
GCAAAGCTCAAGGCACTCGAAGCTCCTTAATTTAGGGCCAACGAGGATTG
TTTGACTGGAAAAGTCATTTCGAATTAAATCATATTCACTGTAGCATTGG
TTCAACCATTCTACTAACAATCAATTCCAACAATGTTATTCATCTGGAAA
CTATTTTTTTCAACGAACTTACACTTTTGAGCTGTTGACACCGTCGATAC
CTGTTGAGAAGGTGATGTGCACGATCGTTGCAAATTTGAAGAACTTTAAA
AATATCGCATATGTAATGTTAGTTATTATATCTCATAGCAATGTACAAAG
TTCTAAAGTAATGAATGAAGCGCCTAATACAAAGTTCGGAG
back to top