BAP2ALocus_106_Transcript_2/4_Confidence_0.500_Length_4605 (mRNA) Venturia canescens

Overview
NameBAP2ALocus_106_Transcript_2/4_Confidence_0.500_Length_4605
Unique NameBAP2ALocus_106_Transcript_2/4_Confidence_0.500_Length_4605
TypemRNA
OrganismVenturia canescens (vcanescens)
Sequence length4605
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Venturia canescens transcriptome v1.02018-05-04
Sequences
The following sequences are available for this feature:

mRNA sequence

>BAP2ALocus_106_Transcript_2/4_Confidence_0.500_Length_4605 ID=BAP2ALocus_106_Transcript_2/4_Confidence_0.500_Length_4605|Name=BAP2ALocus_106_Transcript_2/4_Confidence_0.500_Length_4605|organism=Venturia canescens|type=mRNA|length=4605bp
TTTTTTTTTTTTTTATACATTTGTTTTTCGATTTTATTAGCGATAAATAA
ACTTACACCTCTTTACAATATGTAACAATTCATTATCGTATGAATGTCGG
AAAAAAATATATATTTATTATATTGTTTCAATACGGCCGTCCAATATTAT
AACTTCATACGATAGATGTTGCGATATATGATCATGTTTATAGTCTACGG
TATTCACGAATTCGGCGTCTCGAGAACGCGAGAGCTGTGAAGTGATTTTT
TTTTTATTAGGAAAAGAATGAATTTGGAATATTTCCCAAAATAATTCGAA
TGACGAAGCAACGAGTTGATTGTGCAAATGAGACATTCGTTAAATTCAGT
CGTCTGAGAATAATATGCTTCGAACGCTGTTGAATGATTCATAAAATTTC
AATTTCTGCGCTTTCGTCATTTGACATAAATTTATTTTCATAATTTTTCA
ATTTTTACATTATTCATGATTTTTTCGATCGTTTCGAAGTTTTATTTATT
CTCATAATTAATTATAAAATCATATCACCGAGAGTTTCTTTAACAATGTC
TCATTTCAATTTTCTGTTAAATGTTATTTTTTATGAAGTTTGAAGTAAAC
AGCGAGAAAAACACGTATTTTCGTAAACGAAACTCCTCATGATCACGTTC
ACATACGATTAATATTCACACATTGGACATCAATGCGCCAAGAGAATTCA
AGTCACATGTATTATTTGAAACCGGCTCATTTAACATTGCAGATTTAGAT
AAAACTACGAAACGAATGCTAGCTCCAATTTTCATCATTATCATTCCCGC
ACACTGATGACGTAACTATTATGATAAAACGCTAATGTTTCACATATCTT
CAATCATTATCTTAACTTTCTACGATTTTCTCTCTTTCTCTCTCTCTCTC
TCTTAAAATGAAAAATGCCAAATGTTTTGTCACTCCCTAGAAGTAAAAAA
ATGAAGAGTTCCAAAATTATTGTACTGTTTAAACGTTTGGTTTGATCATA
GAGAAAGAGAGAGAGAGAGAGAGGGGGGAAACTCCTCACTTTGACACACT
GAGAAAAGTCTTGATATTCTGTGAAATGTTTTCACTCGAAATAGGTTTAT
AATGAACATTGCCAGTTGTAATTCGTCTTTCATTATCCAAACCATTTCGT
ATTGGATTCAACGAAAATTTAGTATTAGGAGTTAAGTGAAATATAACTCA
AAAAATATTATGTTTTTTTACGATATCCAACAAATTTGTTGAATCCAAAA
TAGAATCGGATTGTAATACCATACAAGTCCTTTTCTCAGTTTACAAATTG
TCGATCAAATCTGGGGTGATTCTACAGAGGGGAAGGTTCAATGATGGACG
TGGATGGTCGCGGGTTCAAATTATCATTTGTACTTCAGAATCAATTTTTT
ATTTACAATTCGTTGATTTTCTTTATATTTTTTTTTCGGGAGTCGGAAGA
GACTGACGCAACAATCACGTAATTGTCAATCAACCCATTCCACGCCCATC
CTCATACTATACTATGAATTACTGACATGGGACTGTTGGGAACTACCGAA
TAGACAAAAAGGATCAAATACATGTAGTGATTTGAGGACGTCAATGTGTA
TACGTATGTATTGATCTGCATGGATAAATATCACTTTTACATCACGTTAA
AACGTTGAACCATACACAAGGATCGATCCCCAATAAACGTACAACCGCGA
GAACTTGAGTTATATGTACACGATTCTGTTTGCAAAGCGTTTTTCAATCC
GTTAAGCTGTCATCGAGTCTACTTTGTAATGTCAAAAGCTCGTGGTTGGC
TGCTCGCTTATGATTTATAAAAACAAAAAATATATTTGTATGTCAAGAAT
CTTGACAAACTCACATTCTGCCGCGGTTTCATCGCGAATCGTGTTCTGGC
GGGAGTCCATGTTGAAAGTAATCGCACAACAAAGAATATCAAGAATTAGG
ATTTTATCGAAGGATTTTCGCTTCTCATCCTATGACTATAAGTACATATG
GCGACCCTTGGCAACGCTAGAAATTAAACACAGTACTGTGTATTGCATTC
GATTGAATCAGGCAACGTTTTATATTTGACCGCAATAAAAAATGTTGCCT
TTTTTCAATCGAAAATGGGCCTCGGGAGGACCGAGCGTTGCTCGAAATTG
GGTACATCGAAACGATCGCGGAAAGAACGTTTTCATCATGTTCCCTTCGA
AATGGACCAATCGAGCAGTCTCCTGTATCGTCCGAAGGATGTTACAGTCC
CTCAAATAATCGGCTCCTCATCTGTCTGACTATCGTCCAGTTCTTGGGAA
GTTGCGATCAAAGGAACGGTTGGACACGATGGACTCAATCGTGATTTAAG
TTTGTGTTTCTGACGAGGAGCTTGCTGATGACCTGCAGCATTGCCGGTAG
CGCCACGTGCCAGTATCAATGGTTTCAGAGCCATCCGTAACGACGAGTAA
AGTCGTGGATAAGCGCGTTCTTGTTGTGACATCATTTCTCTATTTTTTTG
TGACTTCTGAGCAACGATTTTTTCGCAAGCTGCACAAGCTACCCTTAAAA
CAGGCAACCTTTTTTCCTCGATGAATTGTCTCAGAGCTCGCTCTCTAACG
TACACGAAAGGTCTGGTGACCCTGAGATCGTATTCTCTAACGTAGTAATG
GGCCTTCATCGTTTTTAATTTTCCGGTATAAAAGAGTGAAGCGAGGAACC
CTTCAGCAAGGTCGTCCAAATGTTGCCCAAGGGCAAGTACGTTATAGCCG
TATCTCTTAGCGACTGCGTAAAGTTGTTTTCTAGTATTGATACCGTCGCG
TCCGCAGACATTGCAAGACCTTCCGGTGAAGTCGGATGTAGCCTCGGCGA
CAGTCTCCAGAGCTGCGATTGCCGAAGGTTCGATGAGGGCAGTTTGTTCC
TCAGCTTCCTCGTAAAAATATGGCACTTGAAGGGCCTTCAAATAACTCAT
AGATTCCATGGGATCGTAGGAACTACCGGCGTCTATCGTGACAGCACCGA
TATCGAAGTCGATACCTTTGGATCTTGCGTAAAATCGATACTGGTGAAGG
GTGTGGAGCAGGGCGAGGGAAAATTTGCCTGCTGCAAGTCCAACACCCAT
GACCGATGCAGGAAGACAAACGAGTATGCGATCTTTGTCTCGTATCATGT
CGAACTCATGGATAGCTTCGACGGTTGCTTTCCAAACGTTTTTCGGCGGA
CTGTGCCACTGAGGTCCGCAAGTTGCTTCATTGTCGACCACGACATCGTG
TTCCTTCTTCGCAATTTTTTGTACAGCTTCGTCCTCGTCATCAGAACTTA
CAACAGGCTCTTCCCTCATCTCATCCTCGGATTGATCGTGTGGTAATTTT
TCATCGCGGCCGCGTCTTCCATTCGGCAGACCGAACGCGGTTTTCGATTT
TCGACAGTACGAACTGTTCCCGTATGATTCGGCACTGCTGCTTCCACTGC
TGCTGCTACTACTGCCACTGCGTCCGAGATCACTTATCGACCTTATATCG
CTCTCATGGAATGAAAGATTTATACCGCTATCTTGCGAGCTCACGGAATT
AACTGCGGAGTAAATTTCCGGAAGTTTCGTTTTTATACCACTGATTTTCG
TCGCTTCTGTGGTGCTCGGTGACTTGTGACTCCGATCCTCTTCTTCATCG
TCATCACCCTCGCCCTCGTCCGATGTCTTGGCTCTGTCATGAACGACATT
CGTCGTTGCTCTCGGGCCTACCACGTATATCACAGTCTCGTCCGACGAGC
ACTCGCTTGACATTTTACTGTCTTGTTGCGCCAGCAATAATTCACTCAGT
TTTCCTGATTTAGCAGGCTTGTGTTGAAGCACCAACGGTGGCGATGGCAA
CGCTCCGGAGCCTCGTCTCTCCGGTGTCCCGTGACTGTTGAAATGTTTAT
CCGAATTTGCAGATGCGCTAGCTAGATCAGGCGAAAATCTACCTAGACCA
TCTACCGCGTTCACCATACACCTGATCTCGGACTTGACTTCGCTCGCCAT
CTCCTTGGAGAACTCCATAAGATACTCGGCTATTTCGCTTGCTGAGAAAG
AATCTTCCGGTCTCTCGTTGCTCGTGGAAGAAGTTCTTTGCGGATGATGT
TGAGGGGTGCTCATCTCTGAAGAGTTACTCTCCGAAAGTACATCGTCGAC
TTTGGATATGACCTCGCGTATTTCCGACTTTATTTCCGTGGCCAGTTCCT
TCGTAACTTCTTAAAGATAAGCGCGAAGATCATCCTCGGTGCTTTGGCTC
ATTTGGGGCAGCACGGGTGAGCACCTTCCGAGACGCGGAGTAGTGTAGCG
TGGGGATGTTTCACCAGCATCGTAATGGACGTTTACGCTCGCATCGTGAT
GATGGTGGTGATGATTATGATAATTATGTTTTTTGACATTGTGATGATGG
TGGTGATGATTGTGAGTGTTGAGGGGAGTGTACGAATAGAGATGAGGCGA
TGGCGATGAGGAAGAAGTCGGCGACGATGTATTGGACGAGAGGGGTGACG
ATCTCGTGAGGCTCTCCGTCGTCATGTCGTATTCGAGCGAGGACGAGAGA
TCGGCCCACGTTTTTCTTCTTCCATCGGGGCCAGGTACGGACACAAGTGC
AGGAT
back to top