BAP2ALocus_106_Transcript_4/4_Confidence_0.625_Length_9045 (mRNA) Venturia canescens

Overview
NameBAP2ALocus_106_Transcript_4/4_Confidence_0.625_Length_9045
Unique NameBAP2ALocus_106_Transcript_4/4_Confidence_0.625_Length_9045
TypemRNA
OrganismVenturia canescens (vcanescens)
Sequence length9045
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Venturia canescens transcriptome v1.02018-05-04
Sequences
The following sequences are available for this feature:

mRNA sequence

>BAP2ALocus_106_Transcript_4/4_Confidence_0.625_Length_9045 ID=BAP2ALocus_106_Transcript_4/4_Confidence_0.625_Length_9045|Name=BAP2ALocus_106_Transcript_4/4_Confidence_0.625_Length_9045|organism=Venturia canescens|type=mRNA|length=9045bp
TTTTTTTTTTTTTTATACATTTGTTTTTCGATTTTATTAGCGATAAATAA
ACTTACACCTCTTTACAATATGTAACAATTCATTATCGTATGAATGTCGG
AAAAAAATATATATTTATTATATTGTTTCAATACGGCCGTCCAATATTAT
AACTTCATACGATAGATGTTGCGATATATGATCATGTTTATAGTCTACGG
TATTCACGAATTCGGCGTCTCGAGAACGCGAGAGCTGTGAAGTGATTTTT
TTTTTATTAGGAAAAGAATGAATTTGGAATATTTCCCAAAATAATTCGAA
TGACGAAGCAACGAGTTGATTGTGCAAATGAGACATTCGTTAAATTCAGT
CGTCTGAGAATAATATGCTTCGAACGCTGTTGAATGATTCATAAAATTTC
AATTTCTGCGCTTTCGTCATTTGACATAAATTTATTTTCATAATTTTTCA
ATTTTTACATTATTCATGATTTTTTCGATCGTTTCGAAGTTTTATTTATT
CTCATAATTAATTATAAAATCATATCACCGAGAGTTTCTTTAACAATGTC
TCATTTCAATTTTCTGTTAAATGTTATTTTTTATGAAGTTTGAAGTAAAC
AGCGAGAAAAACACGTATTTTCGTAAACGAAACTCCTCATGATCACGTTC
ACATACGATTAATATTCACACATTGGACATCAATGCGCCAAGAGAATTCA
AGTCACATGTATTATTTGAAACCGGCTCATTTAACATTGCAGATTTAGAT
AAAACTACGAAACGAATGCTAGCTCCAATTTTCATCATTATCATTCCCGC
ACACTGATGACGTAACTATTATGATAAAACGCTAATGTTTCACATATCTT
CAATCATTATCTTAACTTTCTACGATTTTCTCTCTTTCTCTCTCTCTCTC
TCTTAAAATGAAAAATGCCAAATGTTTTGTCACTCCCTAGAAGTAAAAAA
ATGAAGAGTTCCAAAATTATTGTACTGTTTAAACGTTTGGTTTGATCATA
GAGAAAGAGAGAGAGAGAGAGAGGGGGGAAACTCCTCACTTTGACACACT
GAGAAAAGTCTTGATATTCTGTGAAATGTTTTCACTCGAAATAGGTTTAT
AATGAACATTGCCAGTTGTAATTCGTCTTTCATTATCCAAACCATTTCGT
ATTGGATTCAACGAAAATTTAGTATTAGGAGTTAAGTGAAATATAACTCA
AAAAATATTATGTTTTTTTACGATATCCAACAAATTTGTTGAATCCAAAA
TAGAATCGGATTGTAATACCATACAAGTCCTTTTCTCAGTTTACAAATTG
TCGATCAAATCTGGGGTGATTCTACAGAGGGGAAGGTTCAATGATGGACG
TGGATGGTCGCGGGTTCAAATTATCATTTGTACTTCAGAATCAATTTTTT
ATTTACAATTCGTTGATTTTCTTTATATTTTTTTTTCGGGAGTCGGAAGA
GACTGACGCAACAATCACGTAATTGTCAATCAACCCATTCCACGCCCATC
CTCATACTATACTATGAATTACTGACATGGGACTGTTGGGAACTACCGAA
TAGACAAAAAGGATCAAATACATGTAGTGATTTGAGGACGTCAATGTGTA
TACGTATGTATTGATCTGCATGGATAAATATCACTTTTACATCACGTTAA
AACGTTGAACCATACACAAGGATCGATCCCCAATAAACGTACAACCGCGA
GAACTTGAGTTATATGTACACGATTCTGTTTGCAAAGCGTTTTTCAATCC
GTTAAGCTGTCATCGAGTCTACTTTGTAATGTCAAAAGCTCGTGGTTGGC
TGCTCGCTTATGATTTATAAAAACAAAAAATATATTTGTATGTCAAGAAT
CTTGACAAACTCACATTCTGCCGCGGTTTCATCGCGAATCGTGTTCTGGC
GGGAGTCCATGTTGAAAGTAATCGCACAACAAAGAATATCAAGAATTAGG
ATTTTATCGAAGGATTTTCGCTTCTCATCCTATGACTATAAGTACATATG
GCGACCCTTGGCAACGCTAGAAATTAAACACAGTACTGTGTATTGCATTC
GATTGAATCAGGCAACGTTTTATATTTGACCGCAATAAAAAATGTTGCCT
TTTTTCAATCGAAAATGGGCCTCGGGAGGACCGAGCGTTGCTCGAAATTG
GGTACATCGAAACGATCGCGGAAAGAACGTTTTCATCATGTTCCCTTCGA
AATGGACCAATCGAGCAGTCTCCTGTATCGTCCGAAGGATGTTACAGTCC
CTCAAATAATCGGCTCCTCATCTGTCTGACTATCGTCCAGTTCTTGGGAA
GTTGCGATCAAAGGAACGGTTGGACACGATGGACTCAATCGTGATTTAAG
TTTGTGTTTCTGACGAGGAGCTTGCTGATGACCTGCAGCATTGCCGGTAG
CGCCACGTGCCAGTATCAATGGTTTCAGAGCCATCCGTAACGACGAGTAA
AGTCGTGGATAAGCGCGTTCTTGTTGTGACATCATTTCTCTATTTTTTTG
TGACTTCTGAGCAACGATTTTTTCGCAAGCTGCACAAGCTACCCTTAAAA
CAGGCAACCTTTTTTCCTCGATGAATTGTCTCAGAGCTCGCTCTCTAACG
TACACGAAAGGTCTGGTGACCCTGAGATCGTATTCTCTAACGTAGTAATG
GGCCTTCATCGTTTTTAATTTTCCGGTATAAAAGAGTGAAGCGAGGAACC
CTTCAGCAAGGTCGTCCAAATGTTGCCCAAGGGCAAGTACGTTATAGCCG
TATCTCTTAGCGACTGCGTAAAGTTGTTTTCTAGTATTGATACCGTCGCG
TCCGCAGACATTGCAAGACCTTCCGGTGAAGTCGGATGTAGCCTCGGCGA
CAGTCTCCAGAGCTGCGATTGCCGAAGGTTCGATGAGGGCAGTTTGTTCC
TCAGCTTCCTCGTAAAAATATGGCACTTGAAGGGCCTTCAAATAACTCAT
AGATTCCATGGGATCGTAGGAACTACCGGCGTCTATCGTGACAGCACCGA
TATCGAAGTCGATACCTTTGGATCTTGCGTAAAATCGATACTGGTGAAGG
GTGTGGAGCAGGGCGAGGGAAAATTTGCCTGCTGCAAGTCCAACACCCAT
GACCGATGCAGGAAGACAAACGAGTATGCGATCTTTGTCTCGTATCATGT
CGAACTCATGGATAGCTTCGACGGTTGCTTTCCAAACGTTTTTCGGCGGA
CTGTGCCACTGAGGTCCGCAAGTTGCTTCATTGTCGACCACGACATCGTG
TTCCTTCTTCGCAATTTTTTGTACAGCTTCGTCCTCGTCATCAGAACTTA
CAACAGGCTCTTCCCTCATCTCATCCTCGGATTGATCGTGTGGTAATTTT
TCATCGCGGCCGCGTCTTCCATTCGGCAGACCGAACGCGGTTTTCGATTT
TCGACAGTACGAACTGTTCCCGTATGATTCGGCACTGCTGCTTCCACTGC
TGCTGCTACTACTGCCACTGCGTCCGAGATCACTTATCGACCTTATATCG
CTCTCATGGAATGAAAGATTTATACCGCTATCTTGCGAGCTCACGGAATT
AACTGCGGAGTAAATTTCCGGAAGTTTCGTTTTTATACCACTGATTTTCG
TCGCTTCTGTGGTGCTCGGTGACTTGTGACTCCGATCCTCTTCTTCATCG
TCATCACCCTCGCCCTCGTCCGATGTCTTGGCTCTGTCATGAACGACATT
CGTCGTTGCTCTCGGGCCTACCACGTATATCACAGTCTCGTCCGACGAGC
ACTCGCTTGACATTTTACTGTCTTGTTGCGCCAGCAATAATTCACTCAGT
TTTCCTGATTTAGCAGGCTTGTGTTGAAGCACCAACGGTGGCGATGGCAA
CGCTCCGGAGCCTCGTCTCTCCGGTGTCCCGTGACTGTTGAAATGTTTAT
CCGAATTTGCAGATGCGCTAGCTAGATCAGGCGAAAATCTACCTAGACCA
TCTACCGCGTTCACCATACACCTGATCTCGGACTTGACTTCGCTCGCCAT
CTCCTTGGAGAACTCCATAAGATACTCGGCTATTTCGCTTGCTGAGAAAG
AATCTTCCGGTCTCTCGTTGCTCGTGGAAGAAGTTCTTTGCGGATGATGT
TGAGGGGTGCTCATCTCTGAAGAGTTACTCTCCGAAAGTACATCGTCGAC
TTTGGATATGACCTCGCGTATTTCCGACTTTATTTCCGTGGCCAGTTCCT
TCGTAACTTCTTAAAGATAAGCGCGAAGATCATCCTCGGTGCTTTGGCTC
ATTTGGGGCAGCACGGGTGAGCACCTTCCGAGACGCGGAGTAGTGTAGCG
TGGGGATGTTTCACCAGCATCGTAATGGACGTTTACGCTCGCATCGTGAT
GATGGTGGTGATGATTATGATAATTATGTTTTTTGACATTGTGATGATGG
TGGTGATGATTGTGAGTGTTGAGGGGAGTGTACGAATAGAGATGAGGCGA
TGGCGATGAGGAAGAAGTCGGCGACGATGTATTGGACGAGAGGGGTGACG
ATCTCGTGAGGCTCTCCGTCGTCATGTCGTATTCGAGCGAGGACGAGAGA
TCGGCGTGACTGTTGCAGTTGCAATTGCGATTACCACGACGAAGTGAGTT
TCCTGCACAATTTGCGATCCCAAGACTGGCGAGAGTTTGGGGGCTCAGGG
GTATAGGAACAGCCGGAGATTTCCCCGTTGTACTGCTACCCAGAGAGTTG
CAACGAGCTCTACCGAATCGAGCGCCATCGCCTCCCGAGCTCATCGATCC
CATGCTGTGTTCACCAGCCATCAGCCTAGCTCCTGCAGGCGTAGTTCCAA
GGATCATGGCACTCGTGACAGCCTCACCGAGAGCGAATTTGACAGGAGGC
ATCGGCGATTCGGATCTGGAAGAGGCTGCCGAGGCGACACTCAGCGGTGA
CCCGTGGATCGCGTTGTCACGCGAACCAGCTGACTCTCTTCCGTCTTGTT
CGTCCTTCGCAATCCCTTCGAGAACAATGGGAGGCGCATCGTTCTTTTCT
TCGAATCTTTTGGCAGCTCGAGTCGCGCTGGACGGGACGCTCGTTGGGCT
GATACTCAGTGCTGGCAGACTGTGATGTCTCGGAGAAGAAGGTAAAGTCA
CGGGGGTCGTACCCGTTCGTGGAATATCGCTATTCAATCGTCGTATCGCT
TGGTTCGCGTTCCCATGACTCGTCGGCGAGGAGGTCACCGCTTCGATCTT
GCGTAACTTCCGTTTCCTTAACATCGGATCAAAAGGAAGATCTTGCTTGA
CGTTTTGCGAATTGCCGAGAAGAAGGTCCTGCGCCTCAGCCGGTAGTATG
AACCAGCGGAGCTCTTCGCTCTTCTCCTTGAAAGAGGCGCTGCGATCGAT
CTGCAGTGGGTATCTGTGCGCCATTTTTCTCGCTCTGTTGAAAATATTCC
TGGCCGTCTGAAGACAGTCCGCGTAACTCTGGGGGAATATTCCACCGGCG
CCAGATATCCTTCGCTCCGAGGTGATCATTTTCCCGTCCGTGTATCTTAT
GGAACCCAACCATTTTCGCTCCTTGAACACGCTGTTCGTGTGGTGCCGCC
ATTCACCCGTATCCGGATTGAGAACATACTGGGGCAACAGCTTCCAGCCT
TCGGTAGCCACCATCTTAAGTGCTTCAAGGACAAACGCCAATTCGGTCTC
GGACATGAAGTACGGTAACGATAAACTTGCGAATCCAGGTCGCAATGACT
CCGTCTCGGAATCACCCCGGCTGATGTCTTCTTTGCTTTGAAGGAGCACT
TGCTCGTAGGATTTAGCGAGTTCCTCGTCAATCCCCATGAGATCGTGAGC
ATATCGACCAGCGCAGGCGCAACCACCGCGTGCTTGAACCCCGAAAACAT
CGTTCAGTATGGCGCACACGAAATTATGATGAAGAAAAGTGCCACGGGGA
TGTCGAACCATGAACGAGAATACTGGCAGCCTTTTTATGCTCTGCGACGT
ATTTCCGAGGAGTATGAGTTCCGGTATGGTCCGCACGTGGGCAAAAACTT
GCCTGCAAATTTTGTCCTGACGAGCAATGATCGACTGGGTCGTAACATTT
TCTTTCAGCTGAACAGCAAGCCCGCATCTAATTGATTCGACGACACCCGC
AGATCCGCTCTCTTCTCTTAGCTCGGGATCACGAAGGTAGCGATGGGAGT
CTCGTATGTCTTCGCTGCCAATATCATCGCGAAGGAGTGCTTTTTTGGCG
ACGAGGACGCCCGGTGATTGTGCACCTCCCATGAACTTGTGACCGCTGAA
TATTATGGCGTCCTTGTGAACGGCCGTCTCGCCCACGCCTGGCAAGTGCG
GATTCATGTCCATTTGTACGAAGGGCGCGGCTGAAGTATAGTCCCACACA
CTCAGGGCCCCGTGTTGATGGAGCAGTAAAGTCGTCGCGACGTCATCAGC
CAGGACCCCGGTGATGCAGCTGGCGGCGCTGAAGCAGCCCACGAGGAGTG
GCTGCATGACGCCATCGACCGATCTTTCCTCGACGAGCTTACGGTCGAGA
TCGTTCAGGTCGAGAAAACCATCACGGGTCTCGGCTATTCTCACCACCTT
GGTTCCATGTTCACGCCATGGTCTTAGATTGGCGTGGTGTTCGAAGGGGC
CAACGAAGACGACCATTGGCCTCCTGGGGAGGTCAAGATGGCGAAGAAGA
GTCCGTAAAGCGTCGTCAGTACCATGACCCGTAAAGAGAACAGCGTCTTG
CTCACCGGCACCGACTGCATGCCTTACGATGTCTCTGGCCTCGTGCCTGA
AGAGGGATGATTGGAGACTGCAAATGGTGGTTGAAGCTTTCGTGTCGCCG
AGGCAAGGTAACACCTCTCTGGTTATGTATTCTTCGAGAAACTGTAGAGA
CCGTCCGGATGCGGAGTAATCACAGTAAACCACTTTCCTGCGACCGAAGG
GCCCGAAAAACGTTCCATTTTTTCCAACAACATTGTCATCAATGTACTTG
AGTAGTTTGGTCGTGTCTTCCCCCCTTTTAGTTGCTATTGATTTAGCTGA
TCTCGGTCCTGGGTGCGGAGAGGATATGGATTGATGATAATGCGGATGAG
AATTGTGGGAAGTTGTGCCAGCGGAGGTCGGTTGGTTGGGGAGATTTGAT
CCTGATGAAGGAGGTTGCTGGCCCGAGTGCGCCGCTTCCTCGGGCAACGA
AACGATTCGCCTTTGAGAGCCACTCCAGCTCTTCCCGCTCGAAATCTTCA
CCGAGCAGCTCATCCTTTCATAATGCACGACGAATGATTAACCACGTCTC
TTAACTTCTCCCGAAGATGGATTATTCAAACACAGATAATCACTTTTCAC
TTATCTTAATGTCGGCAGCCTCGCGTCGAACTATGGAAAAGTCTGTTTTG
TCGATTGGCACAGTTGTTATTGTTGAGGTTAAAATAACGCGAGGAACAGA
CGAAAAATTAATGAACAAGTGGAGATATAAAGTTGAAGTATTTGCTCTTG
AACGCTCAAGAATTTCAAAGATTTCTATGCCCTCGCTCAATTCCCGTTCA
AACTTTTGTCTCTTCGTTCACCACTAATTTGCTTGTAAAAACTTGCGTTG
CCCGCACTGAAAAAGCTACTCGAAACGACTCTTTCTTTGTGTAGAATTGG
CTTCAGAGTTACTCGCAATGGAGATAAGGCAGCGATGGATATGACAATAA
CGAGAATAAGTGCCGGGACAAGGGAACGGTGACAAGTGGCGTTTATTCAA
AGTATCTTTCTTCTATCTCCTCTTCACACACACACACACGCGCGCGAACG
CGATTCTGTAAACTCGCTTATTTACGTACTTTATTAACAATAGAGAGAAC
GAAAAATATTCGTCATTAAAAGTGCCACGAAACGTTTGTTCACTCCAACT
ATCTTTCTCCTCTTATCGAATACCTCGGTTCATGTACGAATCACGTGGTA
CGCGATGGTGGCGGTATTCCACTTGCGTCAACTCTGAGAGAGTGCAAGTC
GATAACTAAATGCACTTTGAAGACTCGTGATTCGTAGTTCCAATAGACTC
AACCCTTTTTCCCCTCCCTCGGCTTGCCCGCGGACACAAACGCACTCACG
GTCGAACACTGGCTTCACCACTCGATCGCAATTTAAGTATTTATTTATTT
AGCACTTGTTTATATCCGGAATAACACGTTTCGGATAACCGTTAAGATCG
TTTGTCAAGTCGTCACTTTCCGCCGATCGCGTAACGAGGTATTAAAAAAA
CTTGTTCTATATTTCACGAAAAATGGTTTGTCTGGCTATAAGCAAGGGTT
ACTATTACGAACGATTACGACACGAACGAGAAGACGCGCGCGTTTTCTTC
ACCGGTATTTCTCGTTATTCCACGAATTCCAAGTCTTTTGTGAAAAATCC
CATCCGCTTCAATGTTTTTTCGAGAGCATCTCGTCCGTATATATACAATC
GTAATCTCCTGTGATCGACGAGACCACTTAGAAAATCGACAAAATAAAAT
ACTCTTATCGTCAGTCCTGCTGGCGCGTGTTTTAATGGCACGAGAACCGA
CGACTGTAGTTTTTTGATATTTTTTTTCTCGTATTTTAGCTCCTCTCGAT
ATAATCTACTCACGGCTTTATCGGGACAGTGAGCATCTCTCCGTGTTTAT
TGGGAAATATCCAATTGAGTAACAGCCCGATAAAATGAGAGCGACACTTT
TATCTCCTCATTTTGAGCCCTCTCTCCCTCGTTTCTCTTGTTTTCGTCAC
TCTTATTATGCCTTTTTGTCTCTTCGTGTGACGCGAAGTCTACCGCGCGG
TCTGTCTTACGCTGGACGTTACTAGTCGACTAAATAGCGAGTTGAGTGGG
TTGAGGCCGAGAAGCGCGCGCTTGTTCGGACGTACCGGTGGCGTTTCGAA
GCTCCGGCACGGCTGCTGCTGCCGCTGCTGCTGTTGGCTTTCAACGTATT
ACGTTGCCTCGGCGGTAGGGTACTGGGGGACGGGGAATGGGCAAGTTTAA
AAGCACTATCTTTCACAGTGATGACTCTTAGCGCGCGCGCGTACAAGCTC
GTACGTCTACGAACCAACCTAATATTCACTGTTCGAGCTACACCG
back to top