BAP2ALocus_1070_Transcript_1/1_Confidence_1.000_Length_1645 (mRNA) Venturia canescens

Overview
NameBAP2ALocus_1070_Transcript_1/1_Confidence_1.000_Length_1645
Unique NameBAP2ALocus_1070_Transcript_1/1_Confidence_1.000_Length_1645
TypemRNA
OrganismVenturia canescens (vcanescens)
Sequence length1645
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Venturia canescens transcriptome v1.02018-05-04
Sequences
The following sequences are available for this feature:

mRNA sequence

>BAP2ALocus_1070_Transcript_1/1_Confidence_1.000_Length_1645 ID=BAP2ALocus_1070_Transcript_1/1_Confidence_1.000_Length_1645|Name=BAP2ALocus_1070_Transcript_1/1_Confidence_1.000_Length_1645|organism=Venturia canescens|type=mRNA|length=1645bp
CAACTTATACTTTATTGTTGAAAACACATTGTACAGATATAAATTTTTAT
CACGACTATTGTGATCACGACCTGAGCAGACATAACCAATCGAATTTATT
TAAATTGTAAATCCCTTTGTAAATAGAAATTAATCTGCTTCCATGCGTCG
ACAATAGCATTGCTTTTATAAAAATTTATATCTGTACAATGTGTTTTCAA
CAATAAAGTATAAGTTGGAAGACGAAATAAGCTGACAAAAATGGTACGAT
ACACTGAGTTTCAAGCAGTTGTACTAGCAGGGGGGAAAGGTTCCCGAATG
ACAGAGTTGACGGCGGGTAAACCAAAATGCCTTCTTCCTATTGGAAATAT
TCCAATGATTTGGTATCCTCTCAAACTCCTGGAGAGAGCTGGTTTTACCG
AGGCAATAGTTGTAGTGACAGAAAATATAAAAAATGATGTTGCAACTTGT
GTTGATAAACTGGGCTTTGGAATGAAATTGGAACTGGTAGGAATCCCTGG
TGGAGAAGATCTCGGAACAGCAGATTCAATAAGATCAATTTACGACAAAC
TGTACCACGACTGCATCGTTGTATCGTGTGATTTGATTGCGGATATTGAT
ATTTCTGAACTTGTTGATTCCTTCAGAAAACACAATGCTAGCATTAGTGC
TCTAATGCTTCCAGTTCCTAAAGTACCACATGATTTTGTCACTCCTGGAC
CAAAAAGCAAACAAAAACCAGAAACTGATCTCATCGGCATCGACAACACA
ACCAGTCGCCTTGTGTTCTTGGCTTCTGCTTCAGACTTTGAAGAAACTAT
CAATATCTCAAGAAAATTACTCAGAAAACACAACAGCTTTACTATACACT
CAAAATTGATGGATGCTCATTTGTATATCATCAATAAATGGGTTCTCGAT
TTTTTAGTCCATAACAAAAATTTGAGTACTCTCAAGGGTGAATTATTGCC
ATATGTCGTGAGTAAACAGTTGTCGAGGCCAGCAAAGCAAATGATTGATG
ATAAGAATACGTCGATAGTAAAATTGGACACATTGGATGACATTTTTCGT
TTTGCTGTTGAAAAACCAATTGATGAACTCATTAGAAAGATGTCAGCTTT
CAACGATCATAACACCGATTTGGAGGATGCTTATCACGATGATCCTATCA
GATGTTATGCTCACATGGTCACAGGAAAATTTGGCTTGAGAGCCAATACT
GTTCAGATGTACGCCCTCGCTAATAAAATGTTATCGGAAATTTGGAGCAG
CCCTGAATCCAAGGATGAAGAGTCTTTGTCTGGACCGGTATCTTCAACTG
CAATTGTCAAAAGTACTCAAGTGGACAATTGTCGCATCGATGAAGGTGCC
TTCGTAGATGAGAAAACTTCTCTGAAACACAGTCACATCGGACCTTCAGC
AAACGTCGCTATGAAAACGCGAATTTCCGATAGTATCCTCATGGGAAACG
TTACTGTTGGTCAGAGATGCGTTATAAACAATTGCATTTTATGCAACGGA
TGCGTCATCGACGAAGGGACGGAATTGAAGGATTGTTTAGTTGGGGCCTC
GCACATCGTTGTTTCAGACAGTCGTCATTCTCAGGAAGTTCTCACCGACG
CCGACCGACTTATGGAAATATAATTTTTTTTATCAATAAAGTGCC
back to top