BAP2ALocus_1071_Transcript_1/2_Confidence_0.875_Length_5656 (mRNA) Venturia canescens

Overview
NameBAP2ALocus_1071_Transcript_1/2_Confidence_0.875_Length_5656
Unique NameBAP2ALocus_1071_Transcript_1/2_Confidence_0.875_Length_5656
TypemRNA
OrganismVenturia canescens (vcanescens)
Sequence length5656
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Venturia canescens transcriptome v1.02018-05-04
Sequences
The following sequences are available for this feature:

mRNA sequence

>BAP2ALocus_1071_Transcript_1/2_Confidence_0.875_Length_5656 ID=BAP2ALocus_1071_Transcript_1/2_Confidence_0.875_Length_5656|Name=BAP2ALocus_1071_Transcript_1/2_Confidence_0.875_Length_5656|organism=Venturia canescens|type=mRNA|length=5656bp
GGGTGATAGTTTCTGGCGAAGTCTCAGCGGCGGAACAGAGTGACTGAGTT
TGTTGTGTGCGTGTGCGTATAACCAAGCGTACAACACTCGTTTCTCTCTC
TTTCTCTCCCCGTTGGGTTAGTACAAAATTCTCTTAGCGCTGGTTAGAGT
TCCTCTTCTCTCCATCGGTGCCGGGAGTCTATCACGGCAGAGAGTTCGCG
GTGTGAACGGTTTTTTTTCCAACGTCACGAGAGAGAAATGGAGGTCGAGC
AAGCCGTATCCCGGCCGCATTCCGACCAGGAAAAAATATCGAAGGAAAAT
AGCAGTGCGGCCGGGAATCATGGAGATGCGCATATGAACGGCATGTCCAA
TGGTTATGATCGTAAGAAAGAGCACAAGTCGGAGCACAGGGACAGGGATA
AAGAGAGATCGCACAAGTCCGAACACAGGGACAAGGAACGTAGCAAGGGA
CAAGGAACGTAGCAAGGACAAAGATAAAAGCCATAAGAGCGAGCATCGAG
ACAAGGATAGGCACAAGTCCAGCTCTAGTTCTTCTAAGGACAAGGATAAG
GAAAAACATAGCAGCAGCAAAGATAGCAAAGAAAAAGACAAAAAGAGCAG
CTCCTCTTCGAGCCGAGACAAGGACCATAAGAGTAGTACGAGTAGCTCTT
CGAGCAAGGATAAAGACAAGAGCAAAGATCATCACAAATCTAGTTCGAGT
TCGAAGGACAAACATGCAAGTTCCAAGGATAAAGAAAGTTCGAGCAAAGA
TAAAGATAGTTCCAACAAGGACAAAGAAAGTTCGAGCAAGGATAAAGATA
GTTCCCGGAGTAAGGACAAGCACAAGCATAGTTCCATGAACAGCTCGAGT
TCTCGTGACAAGGACAAGAGTCTATCCTCCAAGGACAAAGACAAAGATCG
CAAACATTCCTCCGAGAAGGACAAGGAAAGGCATTCCAGTTCTCACTCGT
CGCTCGAGAAAGATAAGCATCGTTCCTCAGACAAGGACAAACATCGTCAT
GAGAAAGATCGAGATCGTCATCGTCACGACAAAGATAGATCTAAACACCG
GGATGACAAAAACAAGAAGGAATCAAAGATCAAAGAGGAGCCAAAGATTA
AGGAGGAAAATGATATTAAGACTGAAACTTACGAGAAACAAGAAATTCAT
CACAACAATGTTTACAAGCTTGAAATTAAAGAGGAAGTCAAGTCGCAAAT
CGCAGAGCCCGACTACGACGACGACAGTGGAGAAGAGGCCCCACTGTACA
TCAAAGAGGAAGAGGACGATGTTCGAAACGATGCGACAATGGATTCGACG
GACGGTAACGACACTCGTCTATCGGAGCTTCACAATACAACGTTGAAAAC
TGAGGAAGAATCGGATGAAGATATTCCACTAGGCGCCAGAACTTCGCATA
TCAAACGGAAAGTTGATTTCGATGATGATGATGAGGAGGACATTCCGTTG
TCAGCAAGGAAAAAACCTAAGAAAGAATCCAAGCCGAAGAAAAAAAAGAG
AAAACATTCGGATGACGACGAATACGACGATCTTGAAGAGAAACCGAAAA
AGAAGAACGCCAAGCCCGTGAAATCGGAGACGACGAGTCCCCGAAAGAAG
AAAAAGGTCGAAGAGGAAGCTGAAGTTTGGAAATGGTGGGAAGAAGAAAA
GAAATCAGATGGCTCAAAATGGCATTTTCTGGAACACAAAGGTCCAGTGT
TTGCTCCAGCTTATGAGCCATTGCCGCCGAAGGTAAAGTTCTACTACAAT
GGTAAAGAGATGAAATTGGCTCCGGACACCGAGGAGGTAGCTACATTTTA
CGCTCGTATGTTGGACCACGATTACACAACGAAAGCTGTATTCAATGACA
ACTTCATGCATGATTGGCGTTCTATAATGACGGAGAGTGAAAGATCAAAA
ATAAATGATCTTCAAAAGTGCAATTTCAAGGAGATGCATGCGTATTTCCT
GGAGAAGAGCGAGGAACGTAAAGCGATGTCGAAAGAAGAGAAAAAAGCGT
TAAAAGAAGCGAACGAGGAGGTTGCAAAGGAGTATGGTTTTTGTACGATC
GACGGACACAAAGAGAAAATAGGTAATTTCAAAATAGAGCCACCGGGTTT
GTTCCGAGGCCGTGGAGAGCATCCGAAAATGGGAAAATTGAAAAAACGAG
TGTTGCCAGAGGATGTGCTGATAAATTGTTCGAAAGATTCAAGCATACCG
AAACCACCGCCGGGTCATAAATGGAAGGAGATTCGTCACGATCCGAACGT
AACGTGGCTGGCGTCGTGGACAGAGAATGTACAAGGTCAAGTTAAATACG
TCATGCTTAATCCGTCGAGTAAATTGAAGGGTGAGAAAGATTGGCAGAAG
TACGAAACTGCAAGAAAATTGGCCAAATCCATTGACAAAATAAGAGCAGA
ATATCGCGAGGATTGGAAGAGCAAAGAAATGCGTATCAGACAACGCGCTG
TCGCGCTTTATTTCGTTGACAAATTGGCTCTCAGAGCGGGTAACGAGAAA
GACGAGGATCAAGCTGATACCGTGGGCTGCTGTTCCCTTCGCGTAGAGCA
CATCTCGTTGCATGAGCAAAAAGATGGCAAAGAATACGTCGTTGTGTTCG
ACTTCCTCGGTAAAGATTCTATAAGATATTACAACGAGGTACCTGTCGAA
AAACGCGTTTTCAAAAATCTTGTCCTATTCATGGAAAACAAAGCTCCCGG
CGATGACTTGTTTGATCGTCTCAACACAACCGTGCTGAACAAACATTTGA
ATGAATTGATGGAAGGTCTTACAGCCAAAGTATTCAGGACTTACAACGCT
TCGTGGACGCTGCAACAACAATTAGAGGAATTAACCAATCCCGATGACAC
TATCGCCGAAAAAATTCTTTCTTATAATCGAGCTAATCGGGCCGTTGCCA
TTCTTTGTAACCATCAACGTTCTGTACCAAAAACGCATGCTAAATCTATG
GAAAATTTGAAAGCCAAAATTGAGGCCAAGAAAGAAGCTATCGAGGAAAC
CGAAGCTCAAGTCAAGGACGCTAAACGAGAAGCCAAAAATGGCTCGGTGA
AAGAAAAAGTTAATTATGACAAAAAGAAGAAAGCCCTAGAAAGACTAAAG
GAACAACTTGCCAAATTGGAAGTTCAAGCAACCGACAGAGAGGAAAATAA
GGATATTGCCTTGGGAACTTCAAAACTGAACTACCTCGATCCACGAATCT
CCATTGCATGGTGCAAAAAGAACAACGTCCCCATTGAAAAGATTTACAAC
AAGACTCAACGAGACAAATTCAGATGGGCGATAGACATGGCAACTGCGGA
TTACGTATTTTAATACTTCAACCAGCGAGACAATCCTGGATCTTACAGCA
CCTTCTTCTCTCGTCGTTCGAGGGGATTATAGTAAAATTGACATGGAAAA
CGGCCGGGTAAACTTTATCATGAATGAACGAAAAGAAAGGGCGAGAATGA
GAGTCCGATGCGCCAAAAGACGTGAAATCGAGAACGGAGAAAGAGAAGAA
ACGAGAGATACAGTATAATTTTTTATGTGTACAAGAATAGTGGGATCGCG
AGGGTGTGTGAACATTATTCTAAACAAAAAAGTGCTGTATGAGAAGTAAA
AAAGAAACGGAAGGAGAAAACGTGGAGAAGAACAAACAAAATTTCAGTGG
AGAAGACTCTTATACCTAATGTAATTAGTACATATTTGTAATGGTGACTC
GTGCACTGGATAGCTCGGATGTATGCGTGGGGAAAATAAGGGAGAAATTC
AAAAAAAAGGAAGGCAAGAGAAAATAGAAAAGCAAGGAACTTTGGAATCG
TAATGATAAAGTTTTATTCACTAAACGAACTAAAAAATATGAAGGAGGAG
GGGGCGATGAGAATAACAAGTGTAAGAGAATTATGTGTTGAACGAATTCG
GCAAGAAAAATTGTCGTTTAAGACTCGCGTAAGGAAGTCGTTTAGTTAGA
CATTTCGTATGTGTATGGACTTAGAAAAATACGATTGTACATAAAACAAT
AACGATAATAATGATAATAACAATAATAATGAAGCTCGATTTGAAAAACA
CGATAAACCCGATTAAAAAAAGGAGGAAGCTCTCATTACAGTCTGCGTTT
CGTAAGCCGAAACTTTTACTGGCTCTTTGTATACATAAAACTCAAGATAT
AACCGTTGTTTTTGTCATCAACGGGAAGCAGAACGATCGTGAACGGGAAC
GAAGAGAAAAATTAGTAAAAAATGCGAGTAATATTACACCGGAAATGGAG
ATCAACATGTTTGTGGGCATGTTGTTTTATTTAATGAAAACTTGCAACGT
GTTCTGGTTTTTCTCCGCGGTTTCAAGTTTTGTAGACGCTAAAATTTAGA
CTAGAATAATTTTCAACGGTAATGTGTGCTTTTTAATTGTTAAAGTATTC
AAAACAAAAAATGTCATTTGCACACGTTTCCCTTCCCTGGGTTAGGAGTC
ATAGCGCGCGAGTGCTACGAAAAGAAAATGGTCGTGAAACAGCACCGACA
GGTGTATTTCAGACTCAGAACTACCGAGAAATTACGTTGTTGAGGAACAA
ATGCACTGTGCTCATTCGCAATAAGTCACCTTTCAAATTAAAATGGACTC
TGGCCGTTGCAATGTAATGAACAGGATAATATTTCGTTAAAAAGAAACGA
ACGACGAAAACGTTTTTGAGTTATGGAACATCAAGACGTTGCTGATTCAC
GTTTTATTCCTTCAATCGATAGATCAATCCTACCGAAAATCAATTCTGCT
ATTAACGATTTATAAGGAACAACAACAACAACAAAATTAGAAAAATGAAT
ACGGAAACTCGGAATAACTCGTTATTCTGAATGCAATTTATGCACTTATA
TATATTTATATATATATACACACACCGATGTATATATATATATGTATGAC
GAATATGTACACGCATAATTATATATGAATATATATTTAAGGAAATACTT
GTGCTAAAATCGTGTACGGTATAGAAACAGTGGTTTTTTGTTCTCCCAAA
ACGTTGTTTCGAAAGTGTATATCGTCCGGAGAGCTCGAGTACATTTTATT
TTTAAATTGTTCATAAAAAATTTCTAACGCTGGTAAAATGGAAGGAAAAA
TTCTGTTTTTTCCACCCTCTTTTTTCCTCTTTCTTATTTTTTATTTGCGG
AACTAATAAAAAGCCACTGTTGTCGAAAACTGCCACAAAATCCTCTAGTT
TGAAAATGATCTATCGTTCAGACTCGTCGTTTAAAAAACAAAGTATTTTT
ATTCGATCGAATTTTTCGAACGTACGCATTTCGGCGTGTGTCCATTTTGT
TTCGTTTTACCTCTAATTTTTATCAACAACAATTACAATTTGAAGCTTAA
ATTTCACTGAAAATTATAATTTTTTGACACACCATTCTCTCATTGAATGT
GCCCCGATATCACTGACGAGATGAAAACATTTATTTATGTACGGATCACT
TTTATTTATTCTACTAGGCCAATTATTATTGCTATTTTCTTTTTTCTTAA
TAATCGAATTTCAATTTCGACATGGATAGTTATTGAAAAATGAGTCCAAT
AAGTCTAAGCGTAGATTTAAATAAAATGAAAACAACCAATAATATCATGT
AAGATATTTCTTGTGAGATTATAAAAACAATATTGTTTTTATAATCTCAC
AAGAAA
back to top