BAP2ALocus_1073_Transcript_1/7_Confidence_0.286_Length_3404 (mRNA) Venturia canescens

Overview
NameBAP2ALocus_1073_Transcript_1/7_Confidence_0.286_Length_3404
Unique NameBAP2ALocus_1073_Transcript_1/7_Confidence_0.286_Length_3404
TypemRNA
OrganismVenturia canescens (vcanescens)
Sequence length3404
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Venturia canescens transcriptome v1.02018-05-04
Sequences
The following sequences are available for this feature:

mRNA sequence

>BAP2ALocus_1073_Transcript_1/7_Confidence_0.286_Length_3404 ID=BAP2ALocus_1073_Transcript_1/7_Confidence_0.286_Length_3404|Name=BAP2ALocus_1073_Transcript_1/7_Confidence_0.286_Length_3404|organism=Venturia canescens|type=mRNA|length=3404bp
TCGGGTATTAAAACAATCGTGGTAAATGATCAGTTTAGAAAAATGAAACT
GACGAATTGGATTCTCAGTGACTTGAGAGTCCGAGAAAAGTAAGATTAGG
TTCGCCGATCGCATGAGACATTACACGCGACCGTTCGATGGTTCAAAATT
CTTTTACAATTTTATTACGGATAAACAAGAGCGGCGATGGAACCCACGTC
GTGGCAACAGGCGTACAGAATATTCGTCCGAATCACGAAAGAATTTCCAA
TCAGAGTCTTGGGTTTAGTTTCATGATCGTACTTCCTTAATTCTTCATCT
CGTCGTATTCTTTCTACTTTCTACTTTCAAGTGATAATCCATAATCCTAC
TATAAAAATCGGTATTAGCCTCATCTTTGTATGTGCTATTTTTCTCAGTT
TGGAATGAATTTGCAGTAAGAAACTCTCGCATACTAAAAAATACTGTATA
CAAAAACCGAACATTATTTACAAAAGAAAAACAAAACGGAATATATGACA
TTTAAAGAAATGGTTATCCGCGACCAAAAATGATTATGTACACAAATGAT
TTTGAACGGTTTAAACACTTGCAACATATTCCGTACGTTGAATTTACGGA
AACAAATCAACGATACACCCGTTCACTGGTGATTCATAATTTTCCCTCGT
CGTTATCAATTTTTTATTTGTTAGTTGCACACGTTCGAAATTGACGCTAG
GAATATTGGTATATTTTTTTTCATGTATGACGTGTGCGCACCGTGCTGTC
AAGTGCGTGTCAAAAAAAGATCCGCTTATTAAATAATGATTAACGACAAT
TGACAATATCTTAAAGAGCGTCTCAGTGTCGATGAAAACGTAAAATAAAT
AATAAACTTTCTATTTACGTACAAAGTATCTTTAAATTCAGCAGTATAAA
ATATATTTCAAGACTTTGCTCCATTGCGGGACAAAGATTGAAATAATATT
AATCATTTATATCGCTTAGTGATATTCTAATACGGTTTTATCTTTGTTTC
TCTCTTTATCTTTCTGTCACTCCGTCGAATCTCTAGTTACGACCACATTT
GTTAGTCGTGTATATAAAACAATGGTGACCTCAACGATTGCGTATTTCAG
ATGCAACTAATTTTTCCTTTCGAATTTCCTGTAGTCAGAATTCCTATCGT
TTTCGTACCACTTTCACGGTACAGCTCGAAATTGCTGTTTCTCGTTTGGT
TTCAACGGAGCCAACCTCAATACCGTTATCAACGGGTATTCGAGACGATA
AAAATAATTACCATAATGATAGAATTCTGAGTTATTTTGTTACATAGGAC
TAGTCGTAACTCCGTTACGAAGATGCACTGTGCTATCTCTTCTCAATATT
ATCTGTTCGGGTTCCAAATCCCCGTCTTCGATTCCAACTTCGTCGAAACT
GCTCACCGATCTAGAAGCACCTTGCAACTCCTCCAACTTGACTTCTGCCA
CCCACTCGGATATCTCATTCGTATACATTCGTCTCTGGAGCACTTCTCGT
GTCCGAGGTCGTGAACCAATGAACGCGGCAGTTCCGCCAACGACCAAATT
CGACCGCAAATGTTCCAAGAGTTGAAAATCTTGTACGATCGCTTGTAATT
CGTCCCATCTCAATTCGACTTCTTCGTGCAGCATTTTCTCCTCATCGCGC
TTGGATGTTGAACGTTTATATTGTATTCTGAATCTGAAAGCCTCCAAGAA
GCTCGACACGACGATCGTTAAAACGATCATCGTTACGAGATAAAAAGTCA
TGAAAAATACACGACTGTAGAGACCGACAGTAAACGCGTACGCGTTCATC
AGTATGAACCAATTGTTGACGACAGTCAGTTCGAAAAGTGTCATTCCACT
CGCCATCAAATTGTCAAAAGTATTGAGATAGTAATATCCCAAAGTTGTAC
TCCTGTTGACGGAATATTTGTAGAATTCTTCGACAGTTGTATTTTGGCAA
CAATTACGCATATCGTATCCGGCGAACATTTCCATGCCGATAATAGCGAA
GAAATAGTACAATATTAACATGACAATCGCGGTAGAGCACATGAGAGGGG
ACAATATCACCAATGTACCGAACACGTCGCGATAACGTTTCTTCACTTTG
AATAACCTCAACATTCTCAAAGGTCTAAAGACAACAAAGAACGTTGCACT
CGGGAAGAGCATAAGACCACAGGCTCCCACGAGTGACATTATCGATGCTC
CCAAATCAAATAGGTTCCAGCCTGAACTCAAATAACGCCTCATTCCAAGT
CCAAGAACTTTTATGAGTGCTTCCGTCACGAATAGTCCTCCGAACAATAA
AGTATCCCAGCTAGCAGCAAATATTCGTGCAGATTCCTCGAGGGAAGCTG
CACGCTGCATAAGCCCATCCAACATCATAATTCCGTTGCCGATAATGAGG
GCATAAACAATTGGCTCAAAGTAGGGCGACATTATACAAGAGTTTGCTCC
GTTGCAGAGCATTTGCAATGGTTTCCAAGCTGTGTGATACCAAGGTACAC
TTGAATACTGTGGTTCCCATTGGAGTGTCGTAACGTCATAAACACTGAGA
AACTCGTCACAGCTCAGTGATCCAGTGCCGGATGCGTTCATGTGTCGAAA
CATTAAGACGATGTCCAGAGTTGCTTTTTGAGGTGCATAGTATCGCATAA
GACCCTCGAATTGACGAAATCTCATTCTATCAGGGCTCTGTTTGGATACA
AGAAGCTTGAAAGCGTGTTGGCAGGCTCGCCTCTTATGGAGATATAATTT
TTTAAATTTGTCACGTTCCGCCGAGGTGAAAGTTTCGTTGACAACGGCCA
GCATGAGATTCATCATGACATATAGCATTGTGCTCAGATAGGATACGAAA
TAGATCGCGTACCATTTGCTTCTCGAAAACGATGGCATCATAACGTCTGG
AAAATTTGCTGTTGTAAGTAAAACAAACAGACTAACGAAGCTGTCCTGCA
GCGTAGCAAAATTTCTGTTAGTCTGAGAGAACATGTAGTAACCAAGTACC
ATGTAGGTCATAATCAAGAATAATAGAAGGCACAACATATCCAAAATCGG
TGGTAGAGTTTGCAATATTTGTCGTATGAATCTTCTGACCCCACCACAGT
ATTTCGTATCGACGAGAAATATTGGTCTGAGTGCTCTTGTCACTCGGAAA
TGCGATGATTGACGAACGAGGACTGTGGTCGCTTCGACGAACATTATCGC
CAATGTTATGCACTTCAGCATCGTTCGTTTGTGTTTCAGTATCGTTCCCC
AACCAATCCAACGCAGCTTGAACGCTAACTCGATTCCAAAATAAATTAAT
CGATTGAAATACTGCTTTTAAGTTCTAAAAACGATCAATGATCCTTTTTA
TATTATGGAGTCGTTAGATAAATATGGCGAGTTGAAAACCTCGAAGATCT
GGAC
back to top