BAP2ALocus_1073_Transcript_3/7_Confidence_0.357_Length_825 (mRNA) Venturia canescens

Overview
NameBAP2ALocus_1073_Transcript_3/7_Confidence_0.357_Length_825
Unique NameBAP2ALocus_1073_Transcript_3/7_Confidence_0.357_Length_825
TypemRNA
OrganismVenturia canescens (vcanescens)
Sequence length825
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Venturia canescens transcriptome v1.02018-05-04
Sequences
The following sequences are available for this feature:

mRNA sequence

>BAP2ALocus_1073_Transcript_3/7_Confidence_0.357_Length_825 ID=BAP2ALocus_1073_Transcript_3/7_Confidence_0.357_Length_825|Name=BAP2ALocus_1073_Transcript_3/7_Confidence_0.357_Length_825|organism=Venturia canescens|type=mRNA|length=825bp
CTTTAATCTTGTATTTCGTGAAGTATTGTGAGTATTTATTATAAAATGTA
AAAATTGATGATTTGAAAACAAACACCATATTTTTCTTGAGGTAAAATAT
GTGCCAATGCGAGCTCGACACATGTGTTCCCTTGAACATTTTATTTGGAG
CAATGGATCGATTATATACATGCAACCAGTTAATCTGCTTTGTGCTGGAT
TAGTCTGGTTCAAATGGAAACCTTTATGGTCGTTTCTCATACAGTTATAA
GTGGTTGCATAATGAAGAAATAATGATCCGAGGAGGATTTGTTTTGTACA
TATACGAGTTATCGTTCCCCAACCAATCCAACGCAGCTTGAACGCTAACT
CGATTCCAATTGTTGTTAGAGCTAAAAGTTCGATAGAACCATGAGCCCAG
ACTGGTACTTGAAAAAGTGGTACTGCTGGTTCTTCGACGAAAGCCAATGC
CAAGAGGAGCAGAGATGTAAACAAATCAAGTCCATAGTACCAGCTGTTGT
GAACCAACAAATATGCTGGCAAATCGTCCGGATGACGAGGATGTGAATCG
AATTTCTCGTTGTTACGACCTTCCTCTAAAAAGATAGCAGCTTCGTGGTA
ATTCATTTCCCAATGCAAATCTGCATCCAGCATGGTAGATTGTCTGGCGA
AAGCCGCCGTCTCTGACTGGGCATCAGGATCATTTCCTTCGCCAGGTGGT
CTCCCCCGTGAAGTTGATCTGTGACTCAACTCGTTGGGGACAACGCCTTC
GCGAGGTGACATTCTCGAATGACTGTTCGGACTAGTACCGTAAGATGTAT
CCGTTCGATAATTCGGATTGGATTC
back to top