BAP2ALocus_376_Transcript_9/9_Confidence_0.640_Length_8117 (mRNA) Venturia canescens

Overview
NameBAP2ALocus_376_Transcript_9/9_Confidence_0.640_Length_8117
Unique NameBAP2ALocus_376_Transcript_9/9_Confidence_0.640_Length_8117
TypemRNA
OrganismVenturia canescens (vcanescens)
Sequence length8117
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Venturia canescens transcriptome v1.02018-05-04
Sequences
The following sequences are available for this feature:

mRNA sequence

>BAP2ALocus_376_Transcript_9/9_Confidence_0.640_Length_8117 ID=BAP2ALocus_376_Transcript_9/9_Confidence_0.640_Length_8117|Name=BAP2ALocus_376_Transcript_9/9_Confidence_0.640_Length_8117|organism=Venturia canescens|type=mRNA|length=8117bp
TCTCAATAAAATCCCGTCCCACCGCATATATATATATATATATATATATA
CACACGTATTTCCCGTCACTGTGTCTGTCCGTCTGTCGTTCCATCGCAGT
GTCACCCTGTTCGTATTGTTACATCGTGACCAACGATAATCTAGTATTTT
AAACGAATTCTTGGCTCGTTCATATTTTTCCCCTTCTCTTGTTACAGTGA
ATTTATATGGGCGACGCTCTCGTGGGAATATACGCGAATAAACCGTTTTT
AATATAACACGAAGTTTTCTATACAGTGCGTATGTGTGTGTGTGATTCGA
CTGACGTTCGCATACATCAGTACCGAATTGACGGGTTTAACTGAACTTTA
TTGGGAAGAGTTTTCTTCTCTGACAGACGAATTTTAATCGGTTTTTCTAC
TTACGTGCTGCAATCGTGCGTGTGAATACGCCTGTCTATTAAGGACATAT
ACGTTTATGTACACAAATGCGTATGTGCAGGATAAAGAGGCATCCAAGCA
CTTGCAGAATTATACGTCTGGCACGTTCAGAGGAAAATTCGGAGTTACGA
TAAAATGGCGTCACGCGGCAGCACGTCCAGTCTTTTTGAGAAGTGAAAAA
ATAGAACGGTGACGTGCGGACAGACGGAAATATTGATTCGCCAAAAAGAA
ACGACTGTTCCGGTGAAAAATGGTAAAACTTCGTGAAAGTGAAGTTCGTC
TTTTTGGCTAAATTGAAAAATTGAAAAATATATACATATATCAAAAATCA
GGGCCGACCAGAACGACACGAGCGGTGACTACGGTTACTACGCGAACGCA
AGCACGAGAGAGGAAGAGTGAAACACGGAGAGGGAGAGTGCGAGGGGAAG
GTGTGTGTGTGTGTCATGTCTTTGCTCAGTTACGAGAAATTCCTTTGTGC
CAATGGTGAAGAGATTCGATGAGAATCGAAAAGGAAAAAGAAGAAATATA
CGGTGAACGAAGAAGGTGGAACATAGTCGTCAAATGATTTGTCTCGATCA
GCAAAAGACCTCGTCGAAGAAACGATCGAGAAGAAGAAGAGGCTCATTTG
ACGTTGCCGTTTTAGTCGCCGTACTTGGATCACGAAGGTGGAGAACTTTG
TAGCGGCGTGTCGCTGCGAGAAAAAGAAAGAGGAAAAAAACAACAGTAGC
ACACACACGGAATAATTCAGTACTTTTTTTTCATTTCGTTTAAAAAAAAT
CTGTGTGTGTTTCGTGATTCAGTGCTATAGGACATTATTAACCCGTAAAT
CGTGGCAAGGATTACATGTAATAAAGTGACAGACCATCAAGTTTTTTCTT
TTTTTTTCCACCGATCTTATGTGTATTCTTCAAAGGGTGTACAGCAGTGT
CAAAACCAGAGAGATATATAAAAATAAAGGGCTACGCGCATGAAGAATTT
TTCGGCTGTGAATACGTCAAAGATCGCATTATATTCTCGTGACGATTATT
TTTTTTGTGTATTTTAATTACTTTTTCCTCATTAATCTCCGTTGATTTTC
GGAAAAACGTCTAAAACACCAGTGCTTTCTGTGTCTAATCGTGAATACAT
AATACATAAACGTAAAAAATGCGTGAATTCAAGGTTGTGGTATTGGGCTC
GGGTGGTGTTGGCAAGTCGGCCCTTACGGTGCAATTCGTGTCTGGTTGTT
TTATGGAAAAATATGATCCTACGATCGAGGATTTTTATCGAAAAGAAATC
GAGGTCGATAACTCACCTTGCGTACTCGAAATTCTCGATACGGCGGGTAC
CGAACAATTCGCCAGTATGAGGGATCTCTACATCAAGAATGGTCAAGGTT
TTGTCGTTGTTTACAGTCTCACGAACCATCAGACGTTTCAGGACATCAAA
GCAATGAAAGAATTGATAACCCGAGTGAAAGGCACCGAGAGGGTTCCTGT
TTTGTTAGTAGCCAATAAACTGGATCTCGATCATCAGCGAGAAGTCGACA
CGGCAGAGGGGAACGCACTGGCGCAATTGTGGGGTTGTCCTTTCGTCGAG
GCGTCTGCAAAAAACCGTACAAACGTCAATGAGATGTTTGCTGAAATAGT
GCGAGAGATGAACTTCAGTCCGGAGAAAGAAAAAAAAAGTTACTGCTGTT
GCAGCGTCCTCTAATAATTAATCAAACTAATTCGGAGCTCCAGAGATTAA
AGTGTTAGTTAAGAAGTTGAGAAAAAAGATGATTCAATAACTGGTATCAA
AGAGAAAAATATAAATCAGTTTCTTCCGGCTGATAAGAGAGTGAACAACG
TCTCGACAGAAAGAAATCAATTAAAAAAAATGAACAATATTCGGCACTAG
GAGATACGTCTGCAAAAGTTGCTACGTAACAGTCGCAACGTTCAAACCTG
TGAATAAATTGCAAAAACTCTGTAATTATAATTTATGACGTACGAAAACG
AGAAAAGAAAGAAAGAAAATGAGAGAGAGAGAGAGAGCGAGAAAGAAGAT
AGAAAATGTATGAAATGGAAGACTATTTACTATGTACGACAATGAAACAA
ATGCGCCGGCTGCACATTTGTTTTCGATTTTGTTTTTTGTACGAAAAGAT
CGTGGCTGCAATTGCCACGGCCAAATATTTTAATATACGCGAATAGTATT
ATGTGTAAACATCATATTGTAATATATATTCATATATATATATATATGTG
ATCATATATATATATATGTATATGTATTGATTAATCATAGTTTGTTAAGC
GGGCAACAAAGAGGGCCGAGAGAGATAGCGTGTGTAAAAGAGAACAAGAG
AGATAGAGAGAGAATGTGTGGACTTAAAGGACCAATGTACTGAGAGGCTG
AGACAAAAGAAGATATTGTCTATACTCCCTCGTTGTGAGAGAGTTTGTTA
ATTGTTAGGGACTGCAAAAGATAATGTTTATTCGATATTCCCTGTGTTTG
GCTTTGCTCAATTAATGAGACGCAGACAGGATGAGATGTGAATTCACTGA
ACCGGGTTTTTTGGTACACGCTCTTCCTTTGCTTTCAAAGAACATTAAAA
ATTATCGTTGCATCTGCCATCTTTAAATTGCTACCAACATTTGCGAGGTG
CTATAAACGAGCGTGAAATAGAAAATGAGAACACTTGAGCTAATCATTGC
TAAAAGTTGCACAATGATTTTCCGGATTTCTTTGAACTTTAGTTCACTTT
ACGCTCAATCGAACCAGAATTCAATCGTCGCAGGTTGCGGATGATACATT
CAATGCACCAACTCTTCTGTATTCAAATTGTGAATTTTCTGCAGCGGCAG
GTTGTTTTTGCGATACAATCATTGAGATTTTGCTTTTGAATATTTTTTTA
TGATAAATTGGTGAACTTGAGAGCGAACCTAGATGGGAGTCAAGGGAAAT
TGTTTGTTTTTATCATTCCAGCGAAAGAATTTCGCGTTCTGTTGCAATAA
TTCAATCAGGGTAAATTTGATTTGTGTCTTGGGATTTTGTTCGATTTTCA
TGAAAAACTGATCATTCGTTTCATCATCTTTTGGTCCTGCGTGATAAATA
ACATTCTGGTCAAACTTCTTGATAGAACTTTACAAACCCTCTTTTTATGG
CAATTGACTAAATTCCTTCGTATCCAAAGCGTTGATGGAAGCAATGATCG
CTGTAAATCGTAAGACAACTATCCCAGTTGTATTTCTCTGCCCACATGAA
ATTCTTTTCATCTTGGTTTATCGTTACTCATTACTTTTCTTTTAAGGAAG
CCGTGCAATCGAATTTTCAATATTATAGTCGATATTAACATGAATGTATC
GTAAGAACTTCCTCCGGGCTTTTCTTCCCATTAGTGATTAAACGATAAAA
ACAAATGTCACGATGGAACAAACTCCCAAATATCGAAATAAAAACAGTTC
TGCTTTTGCATTTTATGAAAATACAGATCTGCAGTTTCAGACTAATTTCA
GTCTTTTCCGGTCATTGCAAGAAATTCATCCACTTGGAATTTTCACTTTT
TTTTCCTCGACGTTATAAAATCTTTAATCGCGCTCTCGAATGCGTTTGTA
ATGTCTCGGAACAGCGTTGATTCGTCTGCAAAAGAAATGTACTTTTCTAA
AATGAAGAATTCAGCGATGTCGTTCGGCTAGATTAATCATTTTCGCAGAT
TATGGAAGGAAGAAGAAAAAAAATAGATGAAACTCTCTAAACCGGGGTTG
TTAGATCTCGCGTTACAAAAGCGACCCTTTCGCCCTTAATGTTTGCCCCG
TTGTTTTTAAGATTTTCGATAAAACATACGTTCTTTCCTTCAATTCGTTT
CTTCGTCTGTTTTTGTTTTGTTTTGTTTTTTTTTTTTTCGTTCAAGAGCT
CTCTCTTCCAACTGTGTGTTGCGTGCAGATAACTCGTATATATAAAAAGA
AAGAAAGAACAAAAAAGAGGAAAAAAAAACATACACGTAAATGTATCCGC
ATCTCTGCATCATACACGTAAATGTATCCGCATCTCTGCATGCTGTAAAA
CTGTACAGAAGAATTTACCTGAAGTCAATGAGTCACAGATAGGAATTTAT
TATACTTTGTACTATTTTGAGAAGAGTAAAAATAACGGCGATGATGTTTT
TGCAAAAAGAACGTGTATTCGATAACGTTTGATGCTATATCCAAAGGTTT
TTTCACGCGAAATAATGAGAAGGAGGAGAAGATATACGAGATGGAAATAA
TGATTATAGTAATAAACGGAAAAGAATAACTATCGAAAAACCGACTGAAC
GTACGAGATTTGTGTCCAGAGGAGTGTCGTTTCGCAAATGACGGCAAAAA
TGGTCAAATAAAAATGAATTAAAATACACACACACACACACACAAACATA
TTACTACGTAACATGATAACGACTTAAACGATCGATTTTTACATGAAGAG
CTTGCTATATGCACCGGACCCGAAAATTTTTGATAAACGTTTCATTTCCA
TTGTCTTCGATTCATTGTTTTTTTGTCTCTCGTATATTTATACCAAGAGA
AATGAACATAATGTGTACAGCTGGGTTCGTAACGTTGCTTCGACGGGAGT
AATTGTGCGAAAAAAGCTCGTTAACTCGCGACGATAATAATAGTTGAATT
AAGAAGCCCTTTGATAACTGCGAAATCGATTTTTACTCGGCAACCGTGTG
CGCATATCAGGAATTAGTAAAAAAATGAAAAATAAAAAATTAAAAAAAAA
AATTAAAAAAATAACACAAGGACGAGCATTTTTGTAAAGAAAAATTGAGA
AATATTCATCGTCAATAAATGAAAGCGGAATCATGGAAAATCATGAATCG
TCACAGTTCTTTCAAAGTTACTCCCGAGGTTCCTTTGACTATCTTGACTA
TCTTATTCGAAGAAAAATGATTAATTCATAGGCGTTGGATGCACAAATTA
ATAAAACTATTGAAATTCATTCAATTTACGAATGTTTGCCTTACGTTACT
GCAAGTCATTTGGAAACGATTTGATTTTTATTTGATTTTTTTTTCATCAC
CGAACGATGCTCGTTCCTTTCTCCAACTGCGGTATATAAGAGATTCGTAC
CTTTCCTCGGTCGCACTAAAAAAAGCGATCTTCGTACGATCGAAGCAAGA
GAAGCGCACGGTGTTTAATTTCCCGTGAGTAAATACTAGAAAAACAAACT
CCGAGAGAAAACGAAGGACTACGGCAATATTGTTGCACGTCAATTTTTTA
ATAACACCTCTAAGCTAAAGATAACTCTCGAGAAGAGTCTCGGTGTAAAG
AAGGAACCTTGTTTTTTACCATTTTTTACAGAATGCGACGGCGAATATTT
TAAATGTGAAAATACCAATAACGAGAGCGTACAGAATGTGTGAGAGAGCG
GGAAAAGCAAATTTTTGAACGGTCGAATCGTTCGTTTTGTCGAACAAATT
GCATTATTCGTTTGGACATGTGTAAAAAAGGGCAAACTAAATCGAGAAGA
AACCACGTGTTTTTGTCATTATGAATTTTTCACTTCGATATACCGAATAG
TCTTTCTGTGATCCTGTAGATGTAAACCACGTTTTTAAAACAAACGGAGA
AAAGATAAACAAGACACGCACACGTTAAAGCGAACGCAAGAACATTCGAG
TCTGCACACTTTTGTAAAAGAACAAAAAATGTCAGATTCGTGACAAAAAT
CTCTCGCGACGACGTCTTCATGAAAATCAACATTGTTCGTTCTTTTCGGT
AATCCAGGCAGTTTCAATACCGAACAATTTTCTAAATTAAGAAAAGAAAA
AAAATGAATTTTCGCAAAACTACTCAAACTCCATAATCACCGTTTTTTTT
TTCATATTCGTTCGTGCTTCACACTTTTTGTAACTCAAAAGCAAAGCAAA
CGAGCGATTGTATAACAATTGTCAAATCTTTAACAGTCATTTTTATCCGA
TTAACGCTATCCGAGTGAAAACAATAAACAGAAAACAAACAATCGATTTT
ATATATATTTCTACGAAAGAACGTTGAGAAAATAGTGAAAAAGTAAGCCA
CACCGCGTCAGCTCATAGTCGTTTGCTTGTCGAGCTCGAAATTGCATATT
TTTCTAAAAAAAAGGTACCAGAAAAGTGAAATACAAAGTAACCGAAACCA
CCCATGCGAACAAAAATAAAATAAGCGTGAAAAACGCGACAACGTTGAGC
GCATTATTTGATTCGTAAAAGTTGAAAAAAAATCTACACAAGACACTACT
GCCGCGGTGAACATTCATAGCGAGAACTTTTTCAGTGTGTATAAAGTAAC
ATTGGCGAAGCAAATTAGCGCCTCCGTGTCGACAGCATATCATCTTTAAG
GACCACAACAACAACAATATTGAAAGGAAATACCAGAAAATACAAACAAA
CTCCACGAATCCGCGGTCTATCGAATTTTTAGCGTCCCTTTTAATTTCGT
CATCGATTCCCGAAAACGATTAGTATTTTTTATTTTTTTTTTTTCCATCG
TTACATATTATCGTAGTCATTTATTACATTTCATTCGCGCAACTGGCTCA
CTTTTATTCATCCATGAAATAAAATTAACTATTGCAACAACAACAACAAA
ATAATTGAGAAAACAAAAGACAAAATACATAAGAAACAACACCACAATTT
AGATGTATATCGGCCTTTCAGTACTACCTGCGTATGGTATTGAGTACGAA
ATATGTTATATTTTTTACAATGTGAAAAATCTGTAAATATTATAGCATCA
AGTTATATGTATATATATATATATATATCTATATGTCTAACCGCATATAA
ATATATATGTAGGAAAATATATATACGTATACATTATAGTAATAATAACA
ATAAAAAAAATTAACTATCTCACACGTAAAAAATTGATAAAGACTACAGT
GAACAGCTTACAGCAAAAAAATGTGCATTAAATATTATAGGTGAAAGTAA
TACATACTTGTCGATCCTTGAGTCGTCTTTTGCATTATTATTATTATTTT
TTTTTTTTTTCGTTTGTTAATAAATCATTATAAAAATCCGTTGTTCCAGA
AACATTTCAATCGGCAGTTGTACACTTGGTTCGTCCTTTTGATATATCCT
TGGAAAAATCGATGTGACAACGAGCCCGAATGTTGTTATCAGTGGAGAAA
AAAAAAAGAAAAAAACAAAAAGAAACTCAACTCGTTGATGCGTTTTCTAT
TACCTCTAGTAGCAGAGCATACCAGTTTGAACGTCTCGAACGTCTATCGT
TTTTTAGTCGTGTTACATATTCGAGACGCATCGATATTGTGGCTCTTTTT
TTTTGACGGCATAACAATCTAGTCATGTAACGAGAAGGAAAAAACAAAAT
CTGTCGCAGTCTTGAAAATTCACGTCTCACGCTGTTACGGGCTTGCGTAA
CGCAATTATTAATCTGAATTATTTTCTTTTTTTTCGCGTGGAAAAAAAAT
GATGCTAAAGACAAGATGTATTTTATTGTTCGTTTTAAATGGCACAAAAT
AAATATTGAAGAAACGTATATAACGGCAAGATTAAACGAAAGTAGTGTGC
GGTTATGGGGGATCGAAGAAAAAACTTGTCAACTCCAATGTCATCGATTG
ATCGTAGCACTCTCGAAGTTTATACATTATTTTTCTCATCGTCCTCCTTC
AAATTATATCTCGACAAGCGATGCACATTTTTTTCTCACAATTCGTGTAT
TTATGAAACTAAAAAAA
back to top