BAP2ALocus_377_Transcript_2/9_Confidence_0.095_Length_959 (mRNA) Venturia canescens

Overview
NameBAP2ALocus_377_Transcript_2/9_Confidence_0.095_Length_959
Unique NameBAP2ALocus_377_Transcript_2/9_Confidence_0.095_Length_959
TypemRNA
OrganismVenturia canescens (vcanescens)
Sequence length959
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Venturia canescens transcriptome v1.02018-05-04
Sequences
The following sequences are available for this feature:

mRNA sequence

>BAP2ALocus_377_Transcript_2/9_Confidence_0.095_Length_959 ID=BAP2ALocus_377_Transcript_2/9_Confidence_0.095_Length_959|Name=BAP2ALocus_377_Transcript_2/9_Confidence_0.095_Length_959|organism=Venturia canescens|type=mRNA|length=959bp
CTTGTACCAAGCCAACGTACCAAAACACGTACTCTCTCTCAGTGTGCTCT
CAGCTCTCAGTTCAGTACAACAGTACTCAGCACTAGCAGTTAGCAGTAGA
TTTTGAAACACGGCCTGGAACGTTTGGGTTGGGTCCTTAACCAACGAAGA
TGGATCTTCAATTACGGACTTTACACTTTTATAAGGATCCATCTCTATTG
CCTCTACTCTTCCTGGTTTAGCGTCAGACTGGAAAGACAGCTTTGACTGT
ATATTGTTTTCGAACTTACTCATTTTTTATTCGCATTGATATCTTATGCC
AATGTTTCAAACAATGAGAAAGCAAATGCTACAAAAAACAAGGAACCGAT
TGCCTATCTGACAATAGTTTCAGAATATCGAGATGGATGAAGAAACACTT
AACAGATTAGCAGCAGAGGCGTTAATAAAGGAAGCTAAAGTAGGAGCACA
GAGAGCCGAAACAATGGGTCCAAGTGGGTGGGTGAAGCCTCGAGAGACGA
TAAACAAGAGATTTTTGCATTCTACAATCCGAAACGTAGTATTATCAAAC
AGGCACAAGCAGCGATCGCGCGAAGATTGTCTTCCACAGCGTTCTTCGAA
AGAAAAAGTTCGTCAGTGTTTGGAGCAAGTAGAAACAAAAAAACAGACGA
AAATCAATTGAGTTTGAAAATATTGTATATTCACTAATTTGCCAAAAACA
TTGAATCTGTACATAATATTGCCTAAAACAATTTAAGTTTCGTACAATAA
ACAATAAACCGAAATCAATCACAATAAAAAACAAACAGAAAATTATCGAA
TGCATTATTTTAGCTCTAGCTTCTGAGTTAAAAGCAATTCGACGATTATT
CAGGTCCATGATTTATTCCTATTCAATTAAATAATCCTTAATAGTTACTA
AGTTCTACCCAAAGTAATTACTTCTGTTAAAAGTATACAGATGTATACAT
ACCTTTTTA
back to top