BAP2ALocus_377_Transcript_6/9_Confidence_0.429_Length_4805 (mRNA) Venturia canescens

Overview
NameBAP2ALocus_377_Transcript_6/9_Confidence_0.429_Length_4805
Unique NameBAP2ALocus_377_Transcript_6/9_Confidence_0.429_Length_4805
TypemRNA
OrganismVenturia canescens (vcanescens)
Sequence length4805
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Venturia canescens transcriptome v1.02018-05-04
Sequences
The following sequences are available for this feature:

mRNA sequence

>BAP2ALocus_377_Transcript_6/9_Confidence_0.429_Length_4805 ID=BAP2ALocus_377_Transcript_6/9_Confidence_0.429_Length_4805|Name=BAP2ALocus_377_Transcript_6/9_Confidence_0.429_Length_4805|organism=Venturia canescens|type=mRNA|length=4805bp
CTTGTACCAAGCCAACGTACCAAAACACGTACTCTCTCTCAGTGTGCTCT
CAGCTCTCAGTTCAGTACAACAGTACTCAGCACTAGCAGTTAGCAGTAGA
TTTTGAAACACGGCCTGGAACGTTTGGGTTGGGTCCTTAACCAACGAAGA
TGGATCTTCAATTACGGACTTTACACTTTTATAAGGATCCATCTCTATTG
CCTCTACTCTTCCTGGTTTAGCGTCAGACTGGAAAGACAGCTTTGACTGT
ATATTGTTTTCGAACTTACTCATTTTTTATTCGCATTGATATCTTATGCC
AATGTTTCAAACAATGAGAAAGCAAATGCTACAAAAAACAAGGAACCGAT
TGCCTATCTGACAATAGTTTCAGAATATCGAGATGGATGAAGAAACACTT
AACAGATTAGCAGCAGAGGCGTTAATAAAGGAAGCTAAAGTAGGAGCACA
GAGAGCCGAAACAATGGGTCCAAGTGGGTGGGTGAAGCCTCGAGAGACGA
TAAACAAGAGATTTTTGCATTCTACAATCCGAAACGTAGTATTATCAAAC
AGGCACAAGCAGCGATCGCGCGAAGATTGTCTTCCACAGCGTTCTTCGAA
AGAAAAAGTTCGTCAGTGTTTGGAGCAAGTAGAAACAAAAAAACAGACGA
AAATCAATTGAGTTTGAAAATATTGTATATTCACTAATTTGCCAAAAACA
TTGAATCTGTACATAATATTGCCTAAAACAATTTAAGTTTCGTACAATAA
ACAATAAACCGAAATCAATCACAATAAAAAACAAACAGAAAATTATCGAA
TGCATTATTTTAGCTCTAGCTTCTGAGTTAAAAGCAATTCGACGATTATT
CAGGTCCATGATTTATTCCTATTCAATTAAATAATCCTTAATAGTTACTA
AGTTCTACCCAAAAGAATGAAACAATTTTTAAAAAATACATTGAATGGTT
CTTACAAAGTTTCGAACCACGTAAAAAGGTATGTATACATCTGTATACTT
TTAACAGAAGTAATTACTTTGCAATAATATGTAGAAATATCGTCACGTTA
AAATCCCGTGTATAAAATAATTATAGTATAATAGTTTATATATATATATA
TATTATATTAAAATAATTTGCATTGATAAGGTTCCACATCGTCGTGGTAG
GGAAGGAAAATTTGCACACGGGATAGTGGGAAACTCGTATTTTTCGTGTC
ATCGCTTCGCAAAGACAACGAACTCAATTGCGAATATAAAAGGTTGTAAA
CTGTTTTCATAATTAAAACAAAAACCTATGCGAAGCTACTATCCGTAATT
TGTGCGTTTCTCCTCAGTTCTCGTATCTGAGATTGCGTATTAAAAAAACG
TCTCGGTAGATCGCTATGTCCCGAGATAAATATAACTTCTTTTAAAATTC
TACTTTAAACGCTAATCCATAAAGGTTTCAAGTATTTTGCGGTAGCGTAA
AACTTTCGAAAATGTGTCGTTGCCAATATTGTACCGGAATCGTTGTAATT
TGTTCATGATTTGATGGTTTTAGGATTCCTACGTCACGTTCCGCTCGGTA
TAAAATGCCGCGAAACAAGCCAGTTCCTCTTTCTTTCTCCGTATACACAA
ATTGAATGAAAAGTATTGAATTTCACTTCTGACCACGTGCAAAACAATGT
GCTATTGCACTATTTTTTATATATTTACAATCTTACGCCGTCTTCGTACC
CAATAATGAGCTACCTCGTTTGACGATCTCATATTTTTCCGTCGGTTTGT
CAAGCGACTTCTTTTTTCAATGATTTTGTAATTTTTTCTGTGTCTGAAAG
AGCGATTTCATGTCGGCCAACGCTTCTTCTATTCTCAAGGCGAACCTCGA
AGCACTCGTATTATCACAACTACGTTTGCTCGATATGTGGAAGAAGATTA
AATCTTCTCCTGCTATTATATAAGATACTCCGTAACCATCATCGGCGACT
GGACCAAATCCACCTCCCGCCGAAATACACTTTGGGAATTTTTTGAGGTC
CAATCTTGCGGTTTGTCCATGTGGTGTCTGTGACGTTGAAAGTCTCCAAG
GCTCGCTTAAAACTTCCCTTAAAAATGGCGAATCAACTTCCAAGTATTTT
GATACTACGTAGAGACAAAATAGATGCCTATCTATTCCACCACCGCACAT
TGCTACTTGATAACTCCTTTGATGTTGGACTGCTGCGTCTTGCAACAACT
GGAACCTTTCTTGTACGGTTTTCGTAGGATCTTCCATCGATTTGACCCAC
GCACAGGACTCAATTGTGCAAGGTCTAACGGTTTCGGTTCTCCCTTCCCG
GTAAAGCCTCGTCATGGAGGCTTCGTAAGTAAGACTGAATTTCCCGGCGT
CTCGATAATAAGCTAATTGAAGTGCCATTTGAATGTAAGCATCAGGTGAC
ATTTTGCAAGTTTTCATGAAACCTTTTCCATAAATATCATGTACGTAAAT
ACGGAGTTCGACATCGTTGAGAAGTTTGTCAGCAACTTGATAAGAACTTT
CGATAGCTTCGATGCACGGAGCAGAAAGATTCCATTGCAAACGGGCCGGC
ACGGGGGGATCGAATTCCGGAGTTCCTTTCGTGTGTCCGTCTTCTTTGTA
TACGCTCTTTATGGCTTCCTCGGACACGGCATATTCCCATAAGTGTGACA
TCACTGCAGCATCTGCCCTGCTCAGTTAGTTATCGCTTCGATTGAGAATT
TACAAAAAAAAAATATAATCGTGACTGCTTGCCGGCTCAGCGGAGAATCC
TCTCAGGATTGCTCACTTCCTCGTTTATTTTGTCAAACATTTTTACAATC
AGATTTTCGCTGAAGCGTTAAAAAAACCGATTCTTTTAAGTGAACTGTAG
TAGAGAGAAGTCTCCGCCGGTAATTCCGGTCTGGCTTGACTGCGATAAAC
AGACGAGTCAGCAATATTTATTTAATGTCATATTAAATTATACTTTTCAA
CACATACTCACCAAGAGTGCTCGGCATTGAATCCAATCCGTCCATTGGTA
CCGAAACACAAAGTGAATGATTTATCGAACCATCGGTCGTGTCCTTTTCC
ATGAAGCAAAATCCGACCGTACTGGTCCAATTTTTCGGGATGTGCAGGAT
CGTATTCGTACGGTACGTCATCGAGGGCGACGATGAAAGCTGCCTTTTCG
ATCAAATCAAGTGAGTTTTTGTTGATTCCCTTGGCGAAGAAATTTTCACG
AGCTTCGGCCCAAGCTTGTCTCTCCCCAGCTGTAAGCGCTGCGAGCCTCT
CTTCACCTGGAGACGGCGACGATTTATCGTTCAATATGTACGCCATTTGT
ATCTCGATCTCACATGGCTGCAATATTCTGTTTTTGTGGTAAATAAGCAC
TTTATAATATCTCCCTCTGTTGTAAACAACGATATGCTTCGAGTCGTTGA
AATGTACTATTTTGTCGGTCTCCAATCCTGGAACCCTCGTTGTGTTGAAC
AGCCTTTCGTATTGCCAGGAGCATAGAGGAACCATATTTTGTAGCATTAT
CGGTTCGAGTTCTTGTCGCTCGATTAATCGTCTGTACTGCAGACAAGAGT
GAATTATGCTGGCTGCTCGAGCAGTCTGAATCTTCGTGGGGTACATGAGA
ATAGCATCGATACCATAAAAATTGGAGTTGACCATGATCGGTGACCGTCC
ACGCAAATAAACGTATTCTTCCCACCAATCAGAAACGTAGTTGCTCGACC
ACCAAGATTTCAGTATCAAATATCGTTGCAGTTTCGAGCCTATTCCAGTC
TCGAATTCCTTAGCCAGCTTTTCCATGCGAGTGTAATTTTCATCGTCCAG
TAGAGGTCGAACGCTCCTCAAGTATCTTTGCATCGTGTCTCGGACCGTGG
GCAATGGCAATCGAGGAAGCGAGCCTTGGAAGCTGTACAACATCGGTTTG
TTCCAGCCGGAAAGCAGCTTCACAAGTATAAGCCACACCCTTGTGGAAAG
CGAGGGTTTTCGACCTCTCGACTCGAAAATCCATCCTTTGTACATCAGCA
CCAACTTGAGGGTATAACGCAGCGCATAGATAGTCACGAGCCAGAGAACA
AATCCGACAACTATTGAACCAGCAAGATGAGCAGATATGGAAGACCCGGA
TAAATAAGGAGCAACTTTGCCAACGAGATCGTAGGGGACTTTGTACCCAG
CAAAATGTATTGCTGTGACGAGGATTATAGTGAGCCAAAGGCTTCCCAAA
GAGGCTGGATAAACTCCAGTCTTCAAGTTGTTGTGAAATCTGAAAAATCT
TTTTTTCCATGACCTTATGCCCGATTGCCAAATGAGGTCGAGAACCTCCC
TATCGAAGTTTACGTCCCATCCTTCGTGGGTTATGGAAAAACTGAAAGCA
ACGGCAGAATGGGCTTCCGCCATGGCTCACCGAGTATTCTTTGTCCTCTT
CGATGATCTTGGAACCGTAATGTAAAAACACTACTCGATTGTTTTTTACA
ACGTTCGAAATTTTTCCGGTACAACACCTGACTGACGGTCGATCGGGCAA
GATTATAATTTTTGTTTATGCGTGTTGTTTTCGTTCTATATCTCGCGAAA
CGAAGAGCGCTCACTGACGCGCTACAATCTGCTGGAGAATCACCAAACTT
TCGCGCGACAACGCGAACGTTAGTCGATGCGAGGCAATTGTGACACACTT
TCCGATTTTTTCTCTTTCTTTAGATTTCTTCCCTTTTTCTTTTTCAATCA
CCCTCGTCCCGAGAAACGGCGCACCTGAGAACAACCGGCGCGTTCTATCC
AGCAACAAACTCGCACTTCCGAACGAAGCTGCGAACTGAGAACTGAGGAC
TGAGG
back to top