BAP2ALocus_377_Transcript_7/9_Confidence_0.524_Length_5000 (mRNA) Venturia canescens

Overview
NameBAP2ALocus_377_Transcript_7/9_Confidence_0.524_Length_5000
Unique NameBAP2ALocus_377_Transcript_7/9_Confidence_0.524_Length_5000
TypemRNA
OrganismVenturia canescens (vcanescens)
Sequence length5000
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Venturia canescens transcriptome v1.02018-05-04
Sequences
The following sequences are available for this feature:

mRNA sequence

>BAP2ALocus_377_Transcript_7/9_Confidence_0.524_Length_5000 ID=BAP2ALocus_377_Transcript_7/9_Confidence_0.524_Length_5000|Name=BAP2ALocus_377_Transcript_7/9_Confidence_0.524_Length_5000|organism=Venturia canescens|type=mRNA|length=5000bp
CTTGTACCAAGCCAACGTACCAAAACACGTACTCTCTCTCAGTGTGCTCT
CAGCTCTCAGTTCAGTACAACAGTACTCAGCACTAGCAGTTAGCAGTAGA
TTTTGAAACACGGCCTGGAACGTTTGGGTTGGGTCCTTAACCAACGAAGA
TGGATCTTCAATTACGGACTTTACACTTTTATAAGGATCCATCTCTATTG
CCTCTACTCTTCCTGGTTTAGCGTCAGACTGGAAAGACAGCTTTGACTGT
ATATTGTTTTCGAACTTACTCATTTTTTATTCGCATTGATATCTTATGCC
AATGTTTCAAACAATGAGAAAGCAAATGCTACAAAAAACAAGGAACCGAT
TGCCTATCTGACAATAGTTTCAGAATATCGAGATGGATGAAGAAACACTT
AACAGATTAGCAGCAGAGGCGTTAATAAAGGAAGCTAAAGTAGGAGCACA
GAGAGCCGAAACAATGGGTCCAAGTGGGTGGGTGAAGCCTCGAGAGACGA
TAAACAAGAGATTTTTGCATTCTACAATCCGAAACGTAGTATTATCAAAC
AGGCACAAGCAGCGATCGCGCGAAGATTGTCTTCCACAGCGTTCTTCGAA
AGAAAAAGTTCGTCAGTGTTTGGAGCAAGTAGAAACAAAAAAACAGACGA
AAATCAATTGAGTTTGAAAATATTGTATATTCACTAATTTGCCAAAAACA
TTGAATCTGTACATAATATTGCCTAAAACAATTTAAGTTTCGTACAATAA
ACAATAAACCGAAATCAATCACAATAAAAAACAAACAGAAAATTATCGAA
TGCATTATTTTAGCTCTAGCTTCTGAGTTAAAAGCAATTCGACGATTATT
CAGGTCCATGATTTATTCCTATTCAATTAAATAATCCTTAATAGTTACTA
AGTTCTACCCAAAAGAATGAAACAATTTTTAAAAAATACATTGAATGGTT
CTTACAAAGTTTCGAACCACGTAAAAAGGTATGTATACATCTGTATACTT
TTAACAGAAGTAATTACTTTGCAATAATATGTAGAAATATCGTCACGTTA
AAATCCCGTGTATAAAATAATTATAGTATAATAGTTTATATATATATATA
TATTATATTAAAATAATTTGCATTGATAAGGTTCCACATCGTCGTGGTAG
GGAAGGAAAATTTGCACACGGGATAGTGGGAAACTCGTATTTTTCGTGTC
ATCGCTTCGCAAAGACAACGAACTCAATTGCGAATATAAAAGGTTGTAAA
CTGTTTTCATAATTAAAACAAAAACCTATGCGAAGCTACTATCCGTAATT
TGTGCGTTTCTCCTCAGTTCTCGTATCTGAGATTGCGTATTAAAAAAACG
TCTCGGTAGATCGCTATGTCCCGAGATAAATATAACTTCTTTTAAAATTC
TACTTTAAACGCTAATCCATAAAGGTTTCAAGTATTTTGCGGTAGCGTAA
AACTTTCGAAAATGTGTCGTTGCCAATATTGTACCGGAATCGTTGTAATT
TGTTCATGATTTGATGGTTTTAGGATTCCTACGTCACGTTCCGCTCGGTA
TAAAATGCCGCGAAACAAGCCAGTTCCTCTTTCTTTCTCCGTATACACAA
ATTGAATGAAAAGTATTGAATTTCACTTCTGACCACGTGCAAAACAATGT
GCTATTGCACTATTTTTTATATATTTACAATCTTACGCCGTCTTCGTACC
CAATAATGAGCTACCTCGTTTGACGATCTCATATTTTTCCGTCGGTTTGT
CAAGCGACTTCTTTTTTCAATGATTTTGTAATTTTTTCTGTGTCTGAAAG
AGCGATTTCATGTCGGCCAACGCTTCTTCTATTCTCAAGGCGAACCTCGA
AGCACTCGTATTATCACAACTACGTTTGCTCGATATGTGGAAGAAGATTA
AATCTTCTCCTGCTATTATATAAGATACTCCGTAACCATCATCGGCGACT
GGACCAAATCCACCTCCCGCCGAAATACACTTTGGGAATTTTTTGAGGTC
CAATCTTGCGGTTTGTCCATGTGGTGTCTGTGACGTTGAAAGTCTCCAAG
GCTCGCTTAAAACTTCCCTTAAAAATGGCGAATCAACTTCCAAGTATTTT
GATACTACGTAGAGACAAAATAGATGCCTATCTATTCCACCACCGCACAT
TGCTACTTGATAACTCCTTTGATGTTGGACTGCTGCGTCTTGCAACAACT
GGAACCTTTCTTGTACGGTTTTCGTAGGATCTTCCATCGATTTGACCCAC
GCACAGGACTCAATTGTGCAAGGTCTAACGGTTTCGGTTCTCCCTTCCCG
GTAAAGCCTCGTCATGGAGGCTTCGTAAGTAAGACTGAATTTCCCGGCGT
CTCGATAATAAGCTAATTGAAGTGCCATTTGAATGTAAGCATCAGGTGAC
ATTTTGCAAGTTTTCATGAAACCTTTTCCATAAATATCATGTACGTAAAT
ACGGAGTTCGACATCGTTGAGAAGTTTGTCAGCAACTTGATAAGAACTTT
CGATAGCTTCGATGCACGGAGCAGAAAGATTCCATTGCAAACGGGCCGGC
ACGGGGGGATCGAATTCCGGAGTTCCTTTCGTGTGTCCGTCTTCTTTGTA
TCCAATTTCCACATCAGTACCGATAGCGTATTCCCACATGGCTCCCATCA
CGGGTGCATCCGCCCTGACAAAGCAGAGAGTACATTCGATACAATTCTAA
TAAAAAAAGCCCACTTTGTTGAAAAGCATTTTGACTTGTTCCCTATCGTG
TCATTATCCATTTTAAGGTTTCCGAGGTTGAAGCAAGGCTCACAGGCACG
TCTAAAGTTGAGCAGCAGTGAATTTTACCCTTTCGATGATTCGAACAAAA
AATGAAATGCCCGTTGATATTCGTCGTCGCATAGTTTTCATTTCTTCCAA
TTTTCGTTTCCACCATTTTGTCTTTATAGCGTAGCGAGAGGAATAAACAT
CATTAAAAAAGTTCAATGATTCGTAAAAGAGTAGGGAGAAAAAAAAGAAA
AACAAAGTAGAGGGGTTAGCGAACGGAGAAGTAACAGAGAATTAAACTTC
GAATATTTCTCGATGTTTTTTTTTTCTTTTGGTTTCTTACACGCTCTTTA
TGGCTTCCTCGGACACGGCATATTCCCATAAGTGTGACATCACTGCAGCA
TCTGCCCAAGAGTGCTCGGCATTGAATCCAATCCGTCCATTGGTACCGAA
ACACAAAGTGAATGATTTATCGAACCATCGGTCGTGTCCTTTTCCATGAA
GCAAAATCCGACCGTACTGGTCCAATTTTTCGGGATGTGCAGGATCGTAT
TCGTACGGTACGTCATCGAGGGCGACGATGAAAGCTGCCTTTTCGATCAA
ATCAAGTGAGTTTTTGTTGATTCCCTTGGCGAAGAAATTTTCACGAGCTT
CGGCCCAAGCTTGTCTCTCCCCAGCTGTAAGCGCTGCGAGCCTCTCTTCA
CCTGGAGACGGCGACGATTTATCGTTCAATATGTACGCCATTTGTATCTC
GATCTCACATGGCTGCAATATTCTGTTTTTGTGGTAAATAAGCACTTTAT
AATATCTCCCTCTGTTGTAAACAACGATATGCTTCGAGTCGTTGAAATGT
ACTATTTTGTCGGTCTCCAATCCTGGAACCCTCGTTGTGTTGAACAGCCT
TTCGTATTGCCAGGAGCATAGAGGAACCATATTTTGTAGCATTATCGGTT
CGAGTTCTTGTCGCTCGATTAATCGTCTGTACTGCAGACAAGAGTGAATT
ATGCTGGCTGCTCGAGCAGTCTGAATCTTCGTGGGGTACATGAGAATAGC
ATCGATACCATAAAAATTGGAGTTGACCATGATCGGTGACCGTCCACGCA
AATAAACGTATTCTTCCCACCAATCAGAAACGTAGTTGCTCGACCACCAA
GATTTCAGTATCAAATATCGTTGCAGTTTCGAGCCTATTCCAGTCTCGAA
TTCCTTAGCCAGCTTTTCCATGCGAGTGTAATTTTCATCGTCCAGTAGAG
GTCGAACGCTCCTCAAGTATCTTTGCATCGTGTCTCGGACCGTGGGCAAT
GGCAATCGAGGAAGCGAGCCTTGGAAGCTGTACAACATCGGTTTGTTCCA
GCCGGAAAGCAGCTTCACAAGTATAAGCCACACCCTTGTGGAAAGCGAGG
GTTTTCGACCTCTCGACTCGAAAATCCATCCTTTGTACATCAGCACCAAC
TTGAGGGTATAACGCAGCGCATAGATAGTCACGAGCCAGAGAACAAATCC
GACAACTATTGAACCAGCAAGATGAGCAGATATGGAAGACCCGGATAAAT
AAGGAGCAACTTTGCCAACGAGATCGTAGGGGACTTTGTACCCAGCAAAA
TGTATTGCTGTGACGAGGATTATAGTGAGCCAAAGGCTTCCCAAAGAGGC
TGGATAAACTCCAGTCTTCAAGTTGTTGTGAAATCTGAAAAATCTTTTTT
TCCATGACCTTATGCCCGATTGCCAAATGAGGTCGAGAACCTCCCTATCG
AAGTTTACGTCCCATCCTTCGTGGGTTATGGAAAAACTGAAAGCAACGGC
AGAATGGGCTTCCGCCATGGCTCACCGAGTATTCTTTGTCCTCTTCGATG
ATCTTGGAACCGTAATGTAAAAACACTACTCGATTGTTTTTTACAACGTT
CGAAATTTTTCCGGTACAACACCTGACTGACGGTCGATCGGGCAAGATTA
TAATTTTTGTTTATGCGTGTTGTTTTCGTTCTATATCTCGCGAAACGAAG
AGCGCTCACTGACGCGCTACAATCTGCTGGAGAATCACCAAACTTTCGCG
CGACAACGCGAACGTTAGTCGATGCGAGGCAATTGTGACACACTTTCCGA
TTTTTTCTCTTTCTTTAGATTTCTTCCCTTTTTCTTTTTCAATCACCCTC
GTCCCGAGAAACGGCGCACCTGAGAACAACCGGCGCGTTCTATCCAGCAA
CAAACTCGCACTTCCGAACGAAGCTGCGAACTGAGAACTGAGGACTGAGG
back to top