BAP2ALocus_377_Transcript_9/9_Confidence_0.143_Length_2092 (mRNA) Venturia canescens

Overview
NameBAP2ALocus_377_Transcript_9/9_Confidence_0.143_Length_2092
Unique NameBAP2ALocus_377_Transcript_9/9_Confidence_0.143_Length_2092
TypemRNA
OrganismVenturia canescens (vcanescens)
Sequence length2092
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Venturia canescens transcriptome v1.02018-05-04
Sequences
The following sequences are available for this feature:

mRNA sequence

>BAP2ALocus_377_Transcript_9/9_Confidence_0.143_Length_2092 ID=BAP2ALocus_377_Transcript_9/9_Confidence_0.143_Length_2092|Name=BAP2ALocus_377_Transcript_9/9_Confidence_0.143_Length_2092|organism=Venturia canescens|type=mRNA|length=2092bp
CTGTACCTGGAGCAGCAGCTTGACACGCTCAATCGGGGCAACGATGGTTT
CCGCCGCTGTGTCGAAAACCATCGTTGCCCCGATTGAGCGTGTCAAGCTG
CTGCTCCAGGTACAGCACATCTCGAAGCAAATCGCCGAGGATCAACGTTA
CAAGGGAATGGTCGATTGCTTCGTCCGTATCCCTAGAGAACAAGGTTTTT
TGAGTTTTTGGCGTGGTAACTTGGCCAATGTCATCCGTTACTTCCCCACG
CAAGCTTTGAACTTTGCCTTCAAAGACAAGTACAAGCAGGTATTCTTGGG
CGGTGTTGACAAGAACACGCAGTTCTGGCGCTACTTCGCTGGAAATCTCG
CCTCTGGTGGTGCTGCTGGAGCAACTTCTCTTTGCTTCGTCTACCCACTT
GATTTCGCCAGAACTAGGTTGGCCGCTGATGTCGGTAAAGCCGGAGCTGA
GCGTGAGTTCAGCGGTCTTGGAAATTGTTTGACCAAGATCTTCAAGACCG
ACGGTCTTGGTGGATTGTACCGTGGTTTCGGAGTATCCGTACAGGGTATT
ATTATCTACCGTGCATCCTACTTCGGTTTCTATGATACCGCACGTGGTAT
GCTTCCCGACCCCAAGAAGACGCCGTTCCTCGTGTCGTGGGGTATCGCGC
AGTGCGTAACGACCGTTTCTGGAATCGTTTCTTATCCCTTCGACACAGTA
CGTAGGCGAATGATGATGCAGTCTGGTCGTGCAAAATCCGAAATTTTGTA
CAAGAACACGCTTCACTGCTGGGCAACGATCTACAGAACGGAGGGTGGCA
ACGCCTTCTTCAAGGGTGCTTTCTCCAACATTCTCCGTGGTACTGGAGGT
GCCCTTGTGCTTGTACTATACGACGAGATCAAGAACCTTCTCTAAGTGAC
CGAATAACGAATAATATTCCCGAACAAACGAAAAAAAGAGTAAACCCTCC
CTCGTAAGAAATCCCCTCACGTTCATCAAATACCAAAATATCCACAAATC
ACGACTACCATCGACAACACAAGAAAACCTTCCCTCTCCTGCCCCATCCC
GAATCAACACTAACAATCGTTAAATCGGGGGAAAGAAACAGCAAAATACC
CGAGTCCTTGGACGCGTTACATCAAACAAAGTAACCAACGATTTCATGAA
TAAATCTCTCATAAGCTGAGGAGTTTTGGTGGTGGCTCGTGAGAAATGCA
CTCGAGCCTTGACATTCACGTGCAAGAAGGGAAAAAAAATAGAAATAACC
GTGGGTCATAGCGTTAGTAAATTGTCTTTAATTTATTGCCGGATTCAGTA
TTTCGCGGCGACTCGCGGTACGCCAAAATAGAAAACGAAGCATGAAAGAA
AGAAGCGAAATGTTATCCACTTAGCACCAAATCTAATCAAGACTTTTGAG
ACGATTCACACGACACGGATGAATAAAAACTCGTTCACGAAGAAACCAAC
GTTGAAACTTATTTTTATTTTTTTGTTTCTTGTTTTCAAAATAATCCGTA
GCCGTTGAAAATTTATGAAATTCATTGGCACGCCGTCCAATTGTGACTAA
GGCGTTATAATCATCAACGTGTACTTCTCAACAACACGAAAGTACGAATT
TAATTTTTAATAATTGATTTAAAAAATGAACATCAAGTCCCGAATCGGTA
ATTGATATTTTGAGATATCGCGTTTAAAGGGAAAAGATCAGCCGAACTTC
GTTAAATAAGAAGAGAAAGAAAACCGATGAACAGGGACGCGCGACGCTAA
AAATCAAGTTTTCGAAAAAAATAAACAACCAACACGATCCATCGACGACG
ATGGCGGGGCACGTAGACCTGGGCTGCCCCCGCCCTTATTCTCGGCCCAT
TGTAGATAATTAATAAAGCTCGTAATGATAATTAAATGCAAGAAACGCGA
TCCATCTACCGAACGTTTTTGTCGAACGTCGCGGAGGATACACCGAGTTT
AGGGGGACGATTTAATTGAATTGCTAACGCAAATGTTGATTTTAAATCAT
CGTGAAAGACGAAAAGTAATACTGCAAAGTAAATCTGCCAGAGAAAAAAG
AAAATACATGAAATCTACTTCGCACTCCGGAAAAAAACTTAC
back to top